Bacterial and eukaryotic gene promoters are regions of DNA that contain binding sequences for (Q 10) and RNA polymerase. RNA polymerase unwinds DNA and makes an MRNA copy. RNA polymerase elongates the mRNA in a transcription is often terminated by the introduction of a (Q 12) in the newly formed mRNA. _' to ' direction (Q 11). In bacteria,

Bacterial and eukaryotic gene promoters are regions of DNA that contain binding sequences for (Q 10) and RNA polymerase. RNA polymerase unwinds DNA and makes an MRNA copy. RNA polymerase elongates the mRNA in a transcription is often terminated by the introduction of a (Q 12) in the newly formed mRNA. _' to ' direction (Q 11). In bacteria,

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

The coding DNA strand of a gene has the following DNA sequence: 5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’ 1) Find the sequence of the mRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the T is substituted with A (count from 5’ end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!
The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1) Find the sequence of the MRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the Tis substituted with A (count from 5' end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!
Consider the following segment of a template strand of DNA: Part A -ATA AGC TTC GAC- What is the mRNA produced for the segment? -UAU-UCG-AAG-CUC- Part B Complete previous part(s) • Part C What is the mRNA if a mutation changes AGC to AAC? Part D Complete previous part(s) Part E What is the MRNA produced if G is inserted at the beginning of the DNA segment?
Match the type of mutation in the bacterial genome with the effect that each would cause in terms of bacterial resistance or susceptibility to antibiotics Insertion in a gene that codes V [ Choose] for an rRNA changing the binding site of an antibiotic Increased resistance to antibiotic Increased susceptibility to antibiotic Mutation in a gene that [ Choose ] increases the expression of an FRNA Mutation in a gene that causes a [ Choose ] premature stop codon in an enzyme that degrades an antibiotic Mutation in a gene that codes [ Choose ] for a ribosomal protein which induces a change in the ribosome exposing the binding site to an antibiotic
Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
The following gene sequence of nucleotides is found on the template (non-coding) strand of a molecule of DNA from a bacterial cell. The promoter of the gene is highlighted in bold letters and the +1 is underlined. Use the genetic code at the end of this packet to answer the following questions. 3'-AGGCATATTACGATGCCGGTACTTGATGATGACGGACCCATTATAGGACATATG-5' a) What is the sequence of the mRNA strand that will be transcribed from this piece of DNA? Indicate which is the 5’ and which is the 3’ end of the mRNA. b) What is the amino acid sequence that will be translated from this piece of DNA
The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the bottom strand is template, which of the following RNA sequences would be transcribed? DNA: 5-'ATAGGCGATGCCA-3' 3'-TATCCGCTACGGT-5' O 5'-UAUCCGCUACGGU-3' O 5'-ACCGUAGCGGAUA-3' O 5'-AUAGGCGAUGCCA-3' O 5'-UGGCAUCGCCUAU-3'
(b) (c) Point mutations in multiple tumor suppressor proteins have been linked to cancer. For example changes in the gene for adenomatous-polyposis-coli protein (APC gene) may result in colorectal cancer. Consider the following DNA sense strand. 3-TAC CGG TTG TGA AGC TGA ATC-5' Derive the mRNA molecule from the given DNA strand sequence above, paying attention to the polarity of the molecule. (i) (ii) (iii) (iv) Write down the polypeptide chain sequence arising from the mRNA molecule of the question above, using the table of the genetic code (Table Q1 overleaf) and indicate the C- and the N-terminus of the peptide chain. Point mutations of a cytosine (C) often lead to the dysfunction of the APC protein. Write down all possible polypeptide chains that can result from all possible DNA mutations of cytosines, disregarding a mutation in the MET/START and STOP codons. Specify which of the point mutations identified in (d) are redundant? For the given tRNA for Thrombin (Thr) write down all…
17) Synthesis of the mRNA starts at the boxed A/T base pair indicated by the box and proceeds left to right on the sequence below. Transcribe and translate this bacterial gene. 5'-GGACCGCGGGGCAGGATTGCTCCGGGCTGTTTCATGACTIGICAGGTGGGATGACTTGGATGGAAAAGTAGAAGGTCATG-3 3'-CCTGGCGCCCCGTCCTAACGAGGCCCGACAAAGTACTGAACAGTCCACCCTACTGAACCTACCTTTTCATCTTCCAGTAC-5′ 1 -+--at - --+-- 80
Below is a double stranded DNA that contains an ORF. Identify the ORF and in the spaces below, first provide the mRNA sequence that would result (in the 5' to 3' direction). Then give the protein sequence this mRNA would encode (in the N to C direction using the 3-letter abreviations and a single space in between). 5'-CTGCGC TAGGCGCAGTAGGGCATCCCACGACA-3' 3'-GACGCGATCCGCGTCATCCCG TAGGG TGC TGT-5' Codon Table: บบบ UUC JUA UUG CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val mRNA sequence: UCU UCC UCA UCG protein sequence: CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala UAU UAC UAA UAG CAU CAC CAA CAG Tyr Stop GAU GAC His Gin AAU Asn AAC AAAG} LUS Asp GAA GAG} Glu UGU Cys UGC UGA Stop UGG Trp CGU CGC CGA CGG AGU AGC Arg Ser AGG} Arg GGU GGC GGA GGG (DO NOT include the 5' and 3' numbers or the N and C. Write only the nucleotides and the abreviations for the amino acids. Include no spaces in the mRNA and a single space in between the amino acid…