Assume that the 3 polypeptide strands shown below form a parallel B-sheet. Select amino acids AA1, AA2, and AA3 so that the parallel B-sheet is amphipathic and remains stable. Glu-lle-Asn-AA1-Cys-Val Ser-AA2-GIn-Leu-Lys-Phe Lys-Met-Cys-Leu-AA3-Val O AA1 = Pro, AA2 = Leu, AA3 = lle O AA1 = Val, AA2 = Leu, AA3 = Asn O AA1 = Ala, AA2 - Gly, AA3 = Leu O AA1 = Phe, AA2 - Arg, AA3 = Ala
Q: Which of the following would be considered a severe mutation? A) Leucine (Leu) > Lysine (Lys) B)…
A: Amino acids are classified based on their properties like whether they are polar or nonpolar,…
Q: Determine the mechanism and base change(s) which resulted in the alteration of the sequence of a…
A: In genetics, the mechanism of base change is defined as the change or replacement of DNA single base…
Q: a. Identify the type of mutation shown below. b. How many amino acids are affected? c. What type of…
A: Mutation - Mutation is defined as the sudden inheritable changes in the structure of the DNA or in…
Q: Write the structure of each of the following peptides. Start with the N-terminal and the COO- on the…
A: Peptides are the sequence of amino acids that are joined through formation of peptide bond. The…
Q: What is the difference between the two salt precipitation methods: salting in and salting out?…
A: The solubility of a protein in solution depends on the concentration of the salt present in…
Q: Which of the following is not correct regarding protein domains or modules such as the…
A: Amino acids when combined with a peptide bond, they form proteins. Proteins are macromolecules made…
Q: What is protein denaturation? Give five agents that can denature proteins Is it possible for a…
A: Proteins are one of the macromolecules that are present in living organisms. Proteins are made of…
Q: A tridecapeptide yields the following fragments when partially hydrolized. Determine the sequence of…
A: A tridecapeptide is an oligopeptide having thirteen amino acid residues.
Q: Would the side chains in the Leu-Thr-Met-Val-Trp-Gly-Pro of a polypeptide be located on the interior…
A: 1.Amino acids that are hydrophobic (water-fearing) in nature are mostly found interior of the…
Q: A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin,…
A: Proteolytic cleavage is basically the process of breaking the peptide bonds between amino acids in…
Q: A sample of an unknown peptide was dividedinto two aliquots. One aliquot was treated with trypsin;…
A: Trypsin is an endopeptidase. It is a serine protease that cleaves after the basic residues such as…
Q: What is the base sequence of the segment of DNA that is responsible for the biosynthesis of the…
A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…
Q: For each of the following sequences determine if they will most likely form an amphipathic α helix,…
A: Proteins are polymers of amino acids. The sequence of amino acids is governed by the sequences of…
Q: Cut the following protein with the Serine Proteolytic enzyme Trypsin. How many peptide fragments are…
A: Protein sequencing is an important aspect in the field of proteomics and molecular biology which…
Q: Which form of flavin adenine dinucleotide is the "reduced" form, FAD or FADH2? Explain
A: Flavin Adenine Dinucleotide: It is a redox active coenzyme associated with various proteins, which…
Q: Some point mutations cause a change in amino acid sequence but nonetheless may have little to no…
A: option f is correct . This is because each group of amino acid belong to same category means . If…
Q: Which amino acid would be attached to a tRNA that read "GGU"? Val (M) Ala (A) Ser (S) 3'- Arg (R) A…
A: Amino acids are the structural unit of proteins, that is made up of carbon, hydrogen, Oxygen and…
Q: Which of the following could be the DNA template for the following protein primary structum…
A: The DNA is transcribed to produce the mRNA which gets translated into protein. Proteins are polymers…
Q: Which of the following sequences is most likely to represent a beta-sheet portion of a protein? O…
A: The β-sheet is a secondary structure motif of the protein structures. it is formed by the β-strands…
Q: The sequence of a peptide is given below. Ala-gly-val-leu-trp-lys-ser-phe-arg-proWhich peptide…
A: Chymotrypsin belongs to a group of enzymes that all use a serine as an active site to cleave peptide…
Q: A protein with which of the following sequences may be more prone to undergo farnesylation? (a)…
A: Prenylation (or lipidation) is a process of "post-translational modification" (PTMs) of proteins by…
Q: After treating one polypeptide with two different proteases (Trypsin and Chymotrypsin), shorter…
A: Introduction Peptides are short chains of amino acids with peptide bonds connecting them.…
Q: A polypeptide is digested with trypsin, and the resulting segments are sequenced: Val-Gly…
A: Trypsin and chymotrypsin are essential serine proteases that are secreted by the pancreas. They play…
Q: Which of the following sequences in the coding strand of the DNA could code for this peptide? Select…
A: Amino acids are coded by codons (trinucleotide sequences of DNA or RNA). Specific codons code for…
Q: A solution of a peptide of unknown sequence was divided into two samples. One sample was treated…
A: Only twenty of the available amino acids are often present in proteins among all the possible amino…
Q: A polypeptide is digested with trypsin, and the resulting segments are sequenced:…
A: Introduction: A number of enzymes catalyze the breakdown of peptide bonds at a specific site in an…
Q: Which amino acids would be expected to produce a similar sickling effect if substituted for Val at…
A: The blood disease Sickle-cell anemia occurs due to a substitution mutation. The mutated form of…
Q: Indicate whether the following sentences is either True or False and CORRECT if False : Monomeric…
A: Monomeric α-catenin is an actin-binding protein that is essential for cell-cell adhesion and…
Q: Identify the primary sequence for the polypeptide that yields these fragments upon treatment:…
A: Proteins are the macromolecules composed of amino acids bound together by peptide bond between amino…
Q: A heptapeptide was analyzed by Pinky. She reacted it with carboxypeptidase and found out that it…
A: Protein sequencing is the method used for determining the amino acid sequence or the primary…
Q: A number of fragments that will be formed by cleaving the peptide Met-Ala-Lys-Met-Arg-Phe-Met-An by…
A: Proteins are one of the macromolecules present in the body. They provide structural support,…
Q: Given the following pKa data for the individual amino acids, estimate the pI for the tripeptide…
A: In the given data pKa of amino acids Thr-Asp-Arg is: Thr-? Asp-3.86 Arg-12.48 N-terminal group-…
Q: What would the order of migration be (bottom to top in the gel) in a SDS-PAGE for the following…
A: Introduction: Sodium dodecyl sulfate-polyacrylamide electrophoresis (SDS-PAGE) is an analytical…
Q: In SDS-PAGE. What chemical is used to ensure that all protein molecules are coated with a negative…
A: Ans SDS
Q: A polypeptide is subjected to the following digestion procedures and the fragments are sequenced.…
A: For this question we just need to to know sites of Trypsin and Cynogen Bromide at which they act and…
Q: A peptide has the sequence NH 2-phe-pro-lys-gly-phe-pro-COOH. Which of the following sequences in…
A: Correct answer :- 5' TTT-CCC-AAA-GGG-TTT-CCC ( option B is correct.)
Q: Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3' O…
A: Answer :- Met-ala-phe-lys-stop DNA…
Q: Like a helices, B sheets often have one side facing the surface of the protein and one side facing…
A: Alpha-helices and beta-sheets are examples of protein secondary structures. Secondary structure…
Q: Cut the following protein with the Serine Proteolytic enzyme Trypsin. How many peptide fragments are…
A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four levels…
Q: 6. Shown below are the amino acid sequences of the wild-type and three mutant forms of a protein.…
A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…
Q: what are the first 4 amino acids in the polypeptide sequence of SARS-CoV-2 surface glycoprotein
A: The coronavirus disease caused by the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)…
Q: Irreversible cleavage of disulfide bridges is achieved by treating the protein with O a. Edman…
A: Asked : Irreversible Cleavage of disulfide bridges can be done by which of option
Q: A peptide has the following sequence: Gly-Ala-Lys-Phe-Asp-Met-Val-Pro-Arg-Ala-Leu. What is the net…
A: The amino acids contain ionizable groups. The ionic form and charge of the amino acids depend upon…
Q: Draw the peptide formed between asparagine and histidine. H,N-CH-ċ-OH H,N- -CH—С—он CH2 ČH2 N° NH2…
A: Introduction: Proteins are one of the major macromolecules that helps in the structure and function…
Q: The translated peptide chain is: Asn-Ser-Arg-Gin. What is the name of the protein?(use lowercase…
A: The Translated peptide is Asn-Ser-Arg-Gln is a tetra-peptide
Q: Write the anticodons for the following amino acids: a) Met b) Trp c) Ser d) Leu
A: The codon is defined as a sequence of three RNA or DNA bases, which correspond with a specific amino…
Q: pu've isolated a novel protein, but you believe what you actually have is mixture of the unmodified…
A: All the techniques described above in the options use one or more criteria to separate the protein…
Q: Using the genetic code provided what would be the corresponding polypeptide sequence for the DNA…
A: Proteins are the building blocks of the body. Proteins are made up of amino acids. All the…
Q: Spell out the name of the polypeptide using three letter codes for each amino acid separated with…
A: Phenyl isothiocynate is the Edman reagent. It reacts with N-terminal amino acid to give phenyl…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro-A polypeptide is digested with trypsin, and the resulting segments are sequenced: Val-Gly Ala-Ala-Gly-Leu-Trp-Arg Arg-Asp-Pro-Gly-Lue-Met-Val-Leu-Tyr-Ala-Ala-Asp-Glu-Lys And the following fragments are produced by chymotrypsin fragmentation: Ala-Ala-Gly-Leu-Trp Arg-Arg-Asp-Pro-Gly-Leu- Met-Val-Leu-Tyr Ala-Ala-Asp-Glu-Lys-Val-Gly What is the sequence of the whole original polypeptide? (Recall that trypsin cleaves a polypeptide backbone at the C-terminal side of Arg or Lys residues, whereas chymotrypsin cleaves after aromatic amino acid residues).A polypeptide is digested with trypsin, and the resulting segments are sequenced: Val-Gly Ala-Ala-Gly-Leu-Trp-Arg Arg-Asp-Pro-Gly-Lue-Met-Val-Leu-Tyr-Ala-Ala-Asp-Glu-Lys And the following fragments are produced by chymotrypsin fragmentation: Ala-Ala-Gly-Leu-Trp Arg-Arg-Asp-Pro-Gly-Leu- Met-Val-Leu-Tyr Ala-Ala-Asp-Glu-Lys-Val-Gly What is the sequence of the whole original polypeptide?
- A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin, and the other with cyanogen bromide. Given the following sequences of the resulting fragments, deduce the sequence of the original peptide. Trypsin treatment: Asn-Thr-Trp-Met-Ile-Lys Gly-Tyr-Met-Gln-Phe Val-Leu-Gly-Met-Ser-Arg Cyanogen Bromide treatment: Gln-Phe Ile-Lys-Gly-Tyr-Met Ser-Arg-Asn-Thr-Trp-MetIdentify the primary sequence for the polypeptide that yields these fragments upon treatment: His-met-thr-met-ala-trp; Leu-asn-asp-phe; Val-lys obtained from chymotrypsin Leu-asn-asp-phe-his-met; Ala-trp-val-lys; Thr-met obtained from CNBRDraw the structure of this peptide: N-Met-His-Tyr-Leu-Asp-Ser-Arg-Leu-C
- A nonapeptide was treated with dithiothreitol to reduce any disulfide bridges, then partially hydrolyzed, giving rise to the following fragments. What was the sequence of the original polypeptide? Phe-Gln-Asn Pro-Arg-Gly-NH2 Cys-Tyr-Phe Asn-Cys-Pro-Arg Tyr-Phe-Gln-Asn O Cys-Tyr-Phe-GIn-Asn-Cys-Pro-Arg-Gly-NH2 O H2N-Gly-Arg-Pro-Cys-Asn-Gln-Phe-Tyr-Cys O Gly-Arg-Pro-Cys-Tyr-Phe-Gln-Asn-Cys-NH2 Cys-Pro-Arg-Gly-NH2-Cys-Tyr-Phe-Gln-Asn O None of these are correct.You have digested a small protein with two different proteases, each protease acting on the protein in separate reactions. These are the peptide fragments generated: Trypsin: IPVK: Ile-Pro-Val-Lys ALEL: Ala-Leu-Glu-Leu HRPGDR: His-Arg-Pro-Gly-Asp-Arg FGADAEDGAMNK: Phe-Gly-Ala-Asp-Ala-Glu-Asp-Gly-Ala-Met-Asn-Lys YLEFISECIIQVLQSK: Tyr-Leu-Glu-Phe-Ile-Ser-Glu-Cys-Ile-Ile-Gln-Val-Leu-Gln-Ser-Lys Chymotrypsin: (Reaction conditions were used to maximize cutting to the C-terminal size of F, W, and Y.) LEF: Leu-Glu-Phe IPVKY: Ile-Pro-Val-Lys-Tyr GADAEDGAMNKALEL: Gly-Ala-Asp-Ala-Glu-Asp-Gly-Ala-Met-Asn-Lys-Ala-Leu-Glu-Leu ISECIIQVLQSKHRPGDRF: Ile-Ser-Glu-Cys-Ile-Ile-Gln-Val-Leu-Gln-Ser-Lys-His-Arg-Pro-Gly-Asp-Arg-Phe I am not sure what these questions are asking.A tridecapeptide yields the following fragments when partially hydrolized. Determine the sequence of amino acids in the tridecapeptidedrolyzed. Determine the sequence of the tri decapeptide. tridecapeptide à lys-arg + gly-phe-pro + phe-ser-asp-lys + pro-phe-ser + asp-lys-arg-val + gln-ala-tyr + val-trp-gln. Determine the sequence of amino acids in the tridecapeptide
- A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin; the other was treated with cyanogen bromide. Given the following sequences (N-terminal to C- terminal) of the resulting fragments, deduce the sequence of the original peptide. Trypsin treatment Asn-Thr-Trp-Met-lle-Lys Gly-Tyr-Met-Gln-Phe Val-Leu-Gly-Met-Ser-Arg Cyanogen bromide treatment Gln-Phe Val-Leu-Gly-Met lle-Lys-Gly-Tyr-Met Ser-Arg-Asn-Thr-Trp-MetA sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin; the other was treated with cyanogen bromide. Given the following sequences (N- terminal to C-terminal) of the resulting fragments, deduce the sequence of the original peptide. Trypsin treatment Asn-Thr-Trp-Met-Ile-Lys Gly-Tyr-Met-Gln–Phe Val-Leu-GlyMet-Ser-Arg Cyanogen bromide treatment Gln–Phe Val-Leu-Gly-Met Ile-Lys-Gly-Tyr-Met Ser-Arg-Asn-Thr-Trp-MetConsider the peptide Asp-Lys-Phe-Glu-Asn-Tyr-Gln-Val-Cys. In a single beaker, you treat this peptide with 2 proteases. One protease cleaves at the N-terminus of aromatic R groups and the other cleaves at the C-terminus of polar, non-ionizable R groups. Following the enzymatic digestion, you want to separate your peptide fragments so that you can identify them. You choose to separate the fragments using an anion exchange column. Beginning at pH=6 you apply your peptide fragments to the column and you gradually decrease the pH of the column stopping the separation when the pH of the column equals 4. Omitting chemical structures, write the amino acid sequence of the peptide fragments that are produced from this digest. Write the order that these fragments will elute from the column (if at all). (Relevant pKa values are: 2.1, 3.8, 4.3, 8.3, 9.6, 10.1, and 10.5)