Andi worked on a construction site for part of the time that she was pregnant with her daughter, Abby. It was later discovered that the paint she was using contained high levels of lead. We know that lead can be harmful to prenatal development. What are two questions you might want to ask in order to understand the relative risk of lead exposure on Abbi’s development?
Q: 8. Name the six classes of enzymes and type of reaction envolve.
A: Note: As per guidelines we can solve one question at a time.ask rest questions to get answer!!…
Q: What variables can affect the transformation efficiency?
A: Introduction The ability of cells to absorb extracellular DNA and express the genes that are…
Q: ISSR is generally a dominant STS DNA marker. Nonetheless, with validated experimental evidence (e.g.…
A: Codominant marker are inherited by both the parents to next generation in equal proportion. When…
Q: 9. List down and explain the factors affecting enzyme activity.
A: Enzymes can be defined as a biocatalyst that increases the rate of chemical reaction,without itself…
Q: 1. Explain heartburn
A: Digestion is a process in which complex food substances is broken down into the simple absorbable…
Q: SITUATION: A 70-year-old retired welder who is a heavy smoker arrives to the emergency room…
A: It is well known that smokers are more prone to a wide range of chronic illnesses and ailments than…
Q: Enzymes that function as decarboxylases are most likely found in ____________ and ____________.…
A: Decarboxylases are a group of enzymes that remove carboxyl groups (CO 2 H) from acidic substrates…
Q: Enzymes catalyze a chemical reaction by A. decreasing the amount of ATP required to activate a…
A: Enzyme is a protein is a substance. Friedrich Wilhelm Kuhne was the one who coined the term ' Enzyme…
Q: Which is not true about this picture?
A: The given picture shows the diagram of leaf of zea mays. Zea mays is more commonly called. It…
Q: (1) Give 3 differences between DNA and RNA (2) Give 2 similarities and 2 differences between…
A: 1) DNA and RNA DNA RNA It is the hereditary and genetic material of cells It is involved in…
Q: 7. Our digestive system produces an enzyme called amylase that breaks starch (amylose) apart into…
A: As the name suggest Amylase (if the word 'ase' is present at the end of the word then most of the…
Q: Match the disease with the pattern of inheritance Phenylketonuria Achondroplasia Red-green…
A: The specific sequence of nucleotides is known as gene. It is present in DNA. It encodes protein.
Q: Which of the following is an illustration of experience-dependent plasticity? A) Rats raised in…
A: Introduction- experiences can profoundly shape the structure and function of the brain. This…
Q: Samples of three different triglycerides, A, B, and C, were tested to determine the melting point of…
A: A graph of melting point of three triglycerides are given in the question and by analysing the…
Q: 1) What is dumping syndrome?what is the cause,symptoms,and the cure of it ? One paragraph
A: Meals, especially food heavy in sugar, passes from stomach into small bowel too rapidly after…
Q: How does a shunt benefit digestion in crocodiles?
A: Shunt It refers to the atypical blood flow through the heart. In spite of having an anatomically…
Q: Carl Woese has recognized that genes encoding rRNAs are excellent candidates for phylogenetic…
A: Genes encoding rRNAs are excellent candidates for phylogenetic analysis, mainly 16S small subunit…
Q: In the following diagram of a replication fork, primers are shown as thick black lines and newly…
A: The heterocatalytic process by which a new DNA stand is synthesized on a old DNA template is known…
Q: The enzymes of the citric acid cycle are located in the a. Inter membrane space of mitochondria…
A: The citric acid cycle is an important metabolic route that links the metabolism of proteins, fats,…
Q: What kind of nutrient pool (atmospheric or sedimentary) characterize the following matter:…
A: The nutrient pools of each of the given cycles can be identified as follows- Phosphorus -…
Q: lateral line, caudal fin, ventral fin, and dorsal fin in a Milkfish?
A: Milkfish - Chanos chanos Belongs to order- Gonorynchiformes and family- Chanidae
Q: If a patient takes 1 tsp TID, how many milliliters will be needed for a 7-day course of therapy?
A: Teaspoon is smaller than tablespoon. 1 tablespoon holds 15ml while 1 teaspoon holds nearly 5 ml.
Q: The diagrams represent four possible phylogenetic relationship between the four species: M, L, S,…
A: The phylogenetic tree represents the evolutionary relationship between taxons in the phylogeny. It…
Q: 26. If 100 mL of a solution for patient-con- trolled anesthesia contains 200 mg of morphine sulfate…
A: Given- 1) Amount of Solution- 100mL. 2) morphine sulfate- 200mg. 3)Droperidol- 8mg To find-…
Q: turtles, lizards, snakes crocodiles dinosaurs parental care keratinized skin amniote egg bipedalism…
A: Phylogenetic tree is a graphic representation of the course of evolution.It provides a way to…
Q: 24. In Drosophila melanogaster, ebony body (e) and rough eyes (ro) are encoded by autosomal…
A: Introduction :- A given gene is said to be autosomal if it is located on a numbered chromosome…
Q: In basidiomycete fungi, where specifically do nuclei from parents combine to make offspring spores?…
A: Introduction: Basidiomycete are the filamentous fungi composed of the hyphae (except yeast) and it…
Q: I. In the fruit fly Drosophila melanogaster, tan body color (B) is dominant to black (b), and dark…
A: The fundamentals of heredity were initially established by Gregor Johann Mendel in the middle of the…
Q: can serology be used to confirm agglutination?
A: Blood is the main medium of transport in human bodies. It carries oxygen to all parts of the body…
Q: Explain what are the advantages and disadavatges of the CIN, MSI, CIMP pathways and the inflammatory…
A: The Mendelian gene is a basic unit of heredity and the molecular gene is a sequence of nucleotides…
Q: true or false The main role of neuroimmune cell units at barrier surfaces is barrier protection .
A: Neuroimmune cells as the name specifies consist of a system that has both nervous system and immune…
Q: dienestrol. Expre a ratio strength.
A:
Q: Match the disease with the pattern of inheritance Phenylketonuria Achondroplasia Autosomal Autosomal…
A:
Q: Discuss the application of the following techniques in histopathology: 1.2.1. Immunohistochemistry…
A: Introduction Histopathology is the study of illness symptoms utilizing a microscopic examination of…
Q: Gluconeogensis uses nearly all of the same enzymes as those in ____, and is a(an) ______ reaction.…
A: The oxygen is required in the aerobic respiration to produce energy in the form of ATP. This aerobic…
Q: QUESTIONS NEED ANSWERED PLEASE a. Describe the soluble and cell surface factors that mediate the…
A: Innate and adaptive immune responses are characteristics of the immune system. The immune system's…
Q: In humans, Tongue roller and widows peak are dominant over non-tongue roller and straight hairline.…
A: Let, W, w - represent alleles of widow's peak & R, r - represent alleles of tongue rolling.…
Q: 1.1 What is the best description of a Ribosome? a. An enzyme that uses ribose to synthesize amino…
A: Ribosomes: All cells contain ribosomes, which are macromolecular machines that carry out biological…
Q: If you have a sodium glucose antiporter in an artificial vesicle, with glucose equal in the vesicle…
A: The movement of ion in the cell membrane occur through channel or carrier protein. Carrier protein…
Q: Why is it important that NEB express I^q cells do not have proteases? What could happen if they did?
A: NEB express Iq cells are E.coli cells, are chemically competent cells with high efficiency and are…
Q: It might be easier to catch a snake in the early morning, compared to night. Why?
A: Snakes belong to the class reptilia of the animal kingdom. These animals crawl and most reptiles…
Q: Ise Describe ONE way that the use of rodenticides affects the kit fox population AND explain how the…
A: The San Joaquin kit fox is of great importance because it is one of the most endangered animals in…
Q: A hemophiliac male puts on Match.com an ad for a ‘Normal’ Homozygous dominant female to mate with.…
A: Haemophilia is an X linked recessive genetic disorder. Let XH - normal X chromosome. Xh -…
Q: describe the molecular switches involved in microbial acute/prolonged starvation response. give one…
A: Microbes adopt a number of strategies during the starvation/stationary period. All these strategies…
Q: Which repeating sequence below would you expect to find on the end of the longest DNA strand of a…
A: Telomeres are nucleotide sequences found at the ends of linear chromosomes. They consist of…
Q: I have a biology question? Approximatley how many molecules of ATP are produced from the complete…
A: Introduction :- Aerobic respiration is the aerobic degradation of nutrients to carbon dioxide,…
Q: What is the role of geography in evolution?
A: Geography can be described as a branch of science that deals with the study of earth surface,and…
Q: What is being separated during anaphase I of meiosis? What happens to the sister chromatids during…
A: Please follow step 2 for detailed explanation.
Q: GENETICALLY MODIFIED CROP: mRNA 5' tRNA nucleus O Į CAGTTAATGGAGCGATGCCTGGATGGAGAAATCAATTAG nucleus…
A: The genetic code is a set of instructions that enable live cells to produce proteins using genetic…
Q: Take a deep breath and relax. The oxygen that you breathe in is directly consumed by the _____ in…
A: The electron transport chain is a step in the aerobic respiration. It produces ATP by oxidative…
Andi worked on a construction site for part of the time that she was pregnant with her daughter, Abby. It was later discovered that the paint she was using contained high levels of lead. We know that lead can be harmful to prenatal development. What are two questions you might want to ask in order to understand the relative risk of lead exposure on Abbi’s development?
Step by step
Solved in 2 steps
- Which of the following statements regarding prenatal development risks is FALSE? a. Cigarette smoking by women has serious adverse effects on prenatal and child development b. Paternal factors can adversely affect prenatal development c. Maternal nutritionplays little role in prenatal developmentAda is a pregnant 28 year old vegan. Her pre-pregnancy weight was 132 Ibs (60 kg), and her BMI was 24. She is now 30 weeks along, and feeling fine. Her current weight is 153 Ibs (68.5 kg).Pia, a nursing student is assisting the obstetric nurse in caring for a 25-year-old G1P0 who seek consult at the clinic for the first time at 20 weeks age of gestation. A priority goal for this patient is that she’ll be able to: a. Record the number of fetal movements four times daily b. Attend prenatal care appointment on a regular basis c. Maintain a steady weight gain d. Explain the process of fetal development
- A full-term male newborn has enlargement of head circumference (3 cm greater than 99% of age range). Body weight is appropriate for gestational age. The cranial sutures are separated. Ultrasonography of the head shows enlargement of the lateral ventricles and thinning of the cerebral cortex. The newborn's maternal uncle had similar abnormalities. Further anatomic studies are most likely to show which of the following? A) Absence of the foramina of Luschka B) Cerebellar astrocytoma C) Holoprosencephaly D) Neurofibromatosis E) Stenosis of the aqueduct of Sylvius F) Tuberous sclerosisThe following clinical scenario contains (4) choose-between-two options: An 11-year-old boy with a history of developmental delay presents to your clinic. His mother states that for the past several weeks, he has been displaying symptoms of self-mutilation, and that he has been complaining of joint pain, especially to his toes and feet. On physical examination, there is marked swelling to the digits of his feet, especially his large toe, with associated redness. Given his clinical presentation, the patient likely has a defect with his (HGPRT / dihydrofolate reductase) enzyme. As a result, the patient most likely has (folate deficiency / Lesch-Nyhan syndrome). In clinical laboratory and urinalysis studies, you would expect this patient to have(lower / higher) levels of urate than normal reference ranges. Furthermore, de novo purine synthesis most likely occurs at a (lower / higher) rate in a healthy individual compared to your patient.You were asked to give an explanation at a local maternity clinic on prenatal development. Your explanation must outline the stages and influence on prenatal development.
- Which of the following statements is NOT true regarding maternal alcohol consumption, cigarette smoking, and use of illicit drugs during lactation? a. Alcohol passes into breast milk and causes sleepiness in the infant. b. Infants drink slightly more breast milk when the mother consumes up to one alcoholic drink per day. c. To minimize the effects of an occasional alcoholic drink, women should drink after breastfeeding, eat a meal with the drink to reduce alcohol absorption, and wait to breastfeed for several hours after drinking. d. Illicit drugs can be delivered through breast milk and cause irritability, tremors, hallucinations, and even death in infants.Children with this condition has the following features: wide or web-like neck; low-set ears; broad chest with widely spaced nipples; high, narrow roof of the mouth (palate); arms that turn outward at the elbows; fingernails and toenails that are narrow and turned upward; swelling of the hands and feet, especially at birth; slightly smaller than average height at birth; slowed growth; and cardiac defects. The statement applies to Turner syndrome only The statement applies to Down syndrome only The statement applies to both Turner syndrome and Down syndrome The statement applies to neither Turner syndrome nor Down syndromeA pregnant patient who is at 32 weeks’ gestation has a cold and calls the office to ask about taking an over-the-counter medication that is rated as pregnancy category A. Which answer by the nurse is correct?a) “This drug causes problems in the human fetus, so you should not take this medication.”b) “This drug may cause problems in the human fetus, but nothing has been proven in clinical trials. It is best not to take this medication.”c) “This drug has not caused problems in animals, but no testing has been done in humans. It is probably safe to take.”d) “Studies indicate that there is no risk to the human fetus, so it is okay to take this medication as directed if you need it.”
- A 25 year old primigravida client in her last trimester of pregnancy calls the physician's office and tells the nurse that she thinks she is in labor. She has several concerns regarding her upcoming labor. What would be the first sign of impending or approaching labor? Your correct response should be: she will have to experience EXCEPT: a. Weight gain and edema b. Decreased dyspnea, increased leg varicosities, frequency of voiding c. Lightening around two weeks before labor d. Increased maternal activity and abdominal muscle tighteningAnna is currently 10 weeks pregnant. It is her first pregnancy. She has very mixed feelings about her pregnancy. While she is happy about it, she is very scared and she does not have much knowledge of what the process entails. A. Discuss with Anna the 3 general risk factors in pregnancy B. Discuss the current period of development that is currently ongoing with the pregnancy. C. Using the stages, briefly explain what usually occurs during labour and delivery. D. Using the biopsychosocial framework, describe how the various forces can influence Anna’s decision on whether or not she would be breastfeeding her child.Katie is 37 years old and about 20 weeks pregnant. When Dr. Crusher talks to a patient about scheduling their ultrasound, she simply tells them that it is a way to check on the progress of the pregnancy. However, Dr. Crusher knows that Katie is very worried about fetal anomalies. Dr. Crusher also carefully explains what exactly they will be looking for on the ultrasound as well as what fetal anomalies might be detected by the ultrasound. What standard goes with this? reasonable person standard professional standard subjective st