AKS 5a: Which of the following combinations is true of the nucleotide composition of a sample of DNA? * O A = C A = G AND C = T OA+C = G +T OG+C = T + A

Q: "supercoiling" mean in the context of DNA structure? Define or explain the difference between…

A: DNA is made up of various nucleotides that store genetic information in it. DNA is packed into a…

Q: Give the base sequence of the complementary DNA strand of the DNA chain with the following base…

A: DNA is a macromolecule composed of individual subunits known as nucleotides. Each nucleotide…

Q: Base on the coding strand of DNA: ATG GGA ATT CGC What is the sequence of the complementary…

A: DNA or DeoxyRiboNucleic Acid is a biomolecule which serves as a genetic material in number of…

Q: and these protect the strands and prevent the separated DNA strands from reannealling at Single…

A: DNA replication is the process by which a molecule of DNA is duplicated. In this, a dsDNA molecule…

Q: A260 of a DNA was found to be high. It was not affected by an increase in temperature. Why?…

A: The Absorbance of DNA is observed to show a broad peak at 260 nm. The absorbed double of stranded…

Q: What does helicase do? Unwinds the double helix Closes the double helix after replication has…

A: DNA replication is the process of production of two identical replicas of DNA from one original…

Q: discuss the effect of temperature on the viscosity of the liquid

A: Viscosity is a measure of resistance of a fluid to flow. It is caused by friction in a fluid.

Q: 39 The Central Dogma describes the flow of genetic information as follows: Select an answer and…

A: DNA are genetic material  which consist of genetic information that needs to passed from one…

Q: ou are given a segment of DNA : 5’  - CATGTCAAC – 3’    What is the complimentary strand?

A: Adenine in DNA always pairs with Thymine and cytosine always pairs with Guanine and vice versa .…

Q: H 1. What type of DNA form (A-form, b-form, Z-form) is represented by the cyan strand in the image?…

A: Nucleic acids are genetic molecules that transfer and store information in cells at the molecular…

Q: The percentage of cytosine in a double-stranded DNA molecule is 40%. What is the percentage of…

A: Base pairs refer to the bases that form the double-stranded nucleic acids. This fundamental unit is…

Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…

A: DNA means deoxyribonucleic acid. DNA acts as the genetic material in most of the organisms present…

Q: Which of the following equations are true for double-stranded DNA?  a) (%G+%T) =(%A+%C) b) (%G+%A)…

A: DNA stands for deoxyribonucleic acid. It is a genetic material that passes from one generation to…

Q: .1. Give the complete complimentary bases of the parent DNA strand according to Chargaff's rule and…

A: The Chargaff’s rule state that the quality of the nitrogenous base pairs in the DNA is always equal.…

Q: Cmet-leu-phe-arg-glu-glu lou-ser-tou E)met-arg-glu-arg-glu-arg 231frecall) Agarose gel…

A: DNA, or deoxyribonucleic acid, is a molecule that holds the biological instructions that distinguish…

Q: What’s Name and definition of the DNA?

A: Cell is the smallest structural and, functional unit of life. It is simple machinery that houses all…

Q: 10. In the diagram below, Transcribe the two new complementary strands of DNA. ,ΑTIGCCAAGT…

A: According to the question, we have seen a diagram, where we have to transcribe the two new…

Q: One DNA strand has the sequence  5' -ATTCCGTAGC-3' what is the complementary strand sequence?

A: DNA ( Deoxyribonucleic acid ) is two stranded structure which act as genetic material in most of the…

Q: C. Deepen (Pagpapalalim ng Kaalaman) Let us practice decoding DNA! Fill in the complimentary DNA…

A: DNA is what codes for all the cellular genetic information on earth . All cellular life forms from a…

Q: 10

A: DNA replication is a process by which new copy of DNA molecules are made by DNA polymerase.

Q: 5-ccuaaucg-34 3'-acctgcctataccggattagetetgatectaagcatgte-5" The diagram above shows an RNA primer…

A: Given -  RNA primer :   B   5'-ccuaaucg-3"    C   Template strand :    A…

Q: DNA in the cell, with a right handed helix and 10 base pairs (BP) per helical turn, is in the: Group…

A: The answer is BDNA WITH  RIGHT HANDED HELIX AND 10 BASEPAIRS PER HELICAL TURN.

Q: Using the complementary base pairing rules in DNA, complete the following base pairs: 3D Adenine -i…

A: According to the complementary base pairing rule in DNA- Adenine and Thymine are complementary to…

Q: Biochemist Erwin Chargaff was the first to discover that, in DNA, [A] = [T] and [G] = [C]. These…

A: In a double-stranded stranded DNA, the amount of purine nucleotide is equivalent to the number of…

Q: Given the choices, a. 25 b. 18 c. 23 d. 21 how many hydrogen bonds are present in a DNA double…

A: DNA is also known as deoxyribonucleic acid. DNA acts as genetic material in most of the organisms…

Q: Q. 1 kbps is same as ___________ Bps.

A: Bps means base pairs. Base pairing occurs in double-stranded DNA and RNA. DNA is deoxyribonucleic…

Q: Describe the basic structure of a DNA? Give the different components of DNA and their function in…

A: Genetics is the branch of biology that deals with genetic material like DNA, RNA, inheritance.…

Q: 19. You have reasonably short, typical, double stranded DNA sequence. Basically how many proteins…

A: DNA's molecular structure is referred described as a "double helix." Two connected strands that…

Q: 1. Write the complementary base sequence for the matching strand in the following DNA section:…

A: DNA or Deoxyribonucleic acid, is a complex molecule that contains all the genetic information which…

Q: Write the base sequence and label the 3' and 5' ends of the complementary strand for a segment of…

A: DNA is a duplex helical molecule, which has complementary base pairs. The complementary strands are…

Q: 1) DNA consists of a series of nitrogenous base molecules held together by weak hydrogen bonds.…

A: Generally, a nucleotide has three components namely,(a) A nitrogenous base.(b) A pentose sugar…

Q: 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write…

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: AKS 5b: When considering the semi-conservative model of DNA replication, how many of the resulting…

A: Semi-conservative replication This replication describes the method of replication of DNA in all the…

Q: A1

A: Eukaryotes and Prokaryotes store genetic information in form of DNA and RNA. Some of them have…

Q: hi i need help with science homework if you do i give 5/5  if this sample is good i might even sign…

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: DNA Replication For the following piece of DNA, draw the replicated piece of DNA the original and…

A: DNA replication is a process by which one molecule of DNA replicates and results in two daughter DNA…

Q: List the DNA bases that will complementary base pair with the following sequence: A-G-C-T-A-C-G

A: There are four nitrogenous base pairs in DNA  Adenine Guanine Cytosine Thymine

Q: 1) What is the size of the following single-stranded piece of DNA? ATCGTGTGCT A) 10 b B) 20 bp C) 20…

A: According to guidelines we have to answer the first question only. so please kindly post the…

Q: Sequence of _______ in a DNA molecule stores genetic information?

A: Genetic material is stored in the sequence of bases along a nucleic acid chain in DNA. This genetic…

Q: Give the full form of DNA.

A: Nucleic acid belongs to the category of the biomolecules. These nucleic acids are basically made up…

Q: 1. Two chains of DNA must run in directions and must be bond to each other. a. Opposite,…

A: Introduction DNA Is The Chemical Name For The Molecule In All Living Things That Conveys Genetic…

Q: Match the correct bases pairs to find the opposite strand of DNA strand of       DNA -  T  G  C…

A: DNA is deoxyribonucleic acid. It is the genetic material which is double stranded, which means it…

Q: Which of the following is NOT either stated or predicted by Chargaff's rule? O #G's = #A's in DNA. O…

A: Chargaff's rule states that the stoichiometric ratio of purine and pyrimidine ratio of DNA is 1:1.

Q: AKS 5a: Which of the following combinations is true of the nucleotide composition of a sample of…

A: DNA is a double helix with complementary nitrogenous bases making hydrogen bonds across the two…

Q: Electric Forces in Biology• Describe how a water molecule is polar.• Explain electrostatic screening…

A: Since we only answer 1 question in case of multiple questions, we’ll answer the first question as…

Q: T. aquaticusgenomic DNA is 34.3% guanosine nucleotides. What fraction of the DNA is adenosine…

A: Chromosome is a storehouse of genetic information. Each chromosome is made up of DNA (…

Q: A B-DNA molecule has 1 million nucleotide pairs. How many complete turns of the helix are there in…

A: Majority of DNA present in the cytoplasm of living cells exist in double helical structure as…

Q: 3. Illustrate a 15 nucleotide DNA molecule. Use the symbols: P for phosphate, S sugar and N…

A: DNA is a polymer of nucleotides which are linked to each other by 3'-5' phosphodiester bond.