(a) What will be the problem during DNA replication if the enzyme primase becomes non-functional? (b) In which step of the central dogma is the genetic information of DNA copied into new DNA strands? (c) Which of the following codons is a start codon: GCU, AUG or UGA?
Q: What is meant by the semiconservative nature of DNA replication?
A: DNA replication is the process of producing daughter strands of DNA from parent strands by the…
Q: What enzyme is responsible for unzipping the DNA during replication?
A: DNA replication is process of synthesizing daughter DNA strands from parent strand in order to store…
Q: representation of DNA replication. Complete your representation for a single helical turn. 2.…
A: Gene expression is a complex process in which a required protein is synthesized by the instructions…
Q: Assume that a certain bacterial chromosome has one origin of replication. Under some conditions of…
A: The replication in bacteria will be bidirectional hence initially two replication fork per Double…
Q: 1.) if a DNA template with the sequence AAGTTTCGCCCCGGG undergoes replication, what will be its…
A: (Note: According to guidelines, we are supposed to answer only three subparts. Please repost other…
Q: Does replication occur in one direction or both directions along the parental (old) strand?
A: DNA replication is the biological process of producing identical replicas of DNA from the parental…
Q: How many replication forks are formed at the origin of replication?
A: The two strands of DNA separate to form two single strands that act as templates for the process of…
Q: How does the process of DNA replication generate mismatch mutations? What mechanisms are available…
A: DNA replication is the process in which dsDNA is copied to produce two identical DNA molecules.
Q: During DNA replication, why doesn’t DNA polymerase move away from the replication fork on both…
A: When the replication of the DNA takes place, an enzyme called helicase begins to unwind the double…
Q: During DNA replication, the two new daughter DNA strands have to be made at the same time in the…
A: Answer: DNA REPLICATION = This is the first step in the central dogma in DNA, where new daughter…
Q: Which strand(s) in the DNA Replication Fork depicted below represent the parent strands?
A: DNA replication is the process by which a double stranded DNA (dsDNA) makes a copy of itself to…
Q: If the DNA sequence A-T-T-G-G-C-C-T-A on an informational strand mutated and became…
A: A point mutation or substitution is a form of genetic mutation where a 1 single nucleotide base is…
Q: Explain how the lagging dna strand is copied during dna replication? What are the enzymes involved?
A: The nascent deoxyribonucleic acid (DNA) consists of one leading strand and one lagging strand.
Q: If the sequence 5′-AACGC-3′ were damaged by reactive oxygen species, what would be the most…
A: Mutation is the process by which the sequence of DNA is altered and can result in deleterious…
Q: What would happen if, in the course of replication, the topoisomerases were unable to reattach the…
A: Replication is the process of copying the DNA molecule to form two daughter DNA strands before the…
Q: Suppose that 28% of the nucleotides in a DNA molecule are deoxythymidine 5′- monophosphate, and that…
A: DNA is a double stranded helical polynucleotide. It usually consists of two helices, sequences of…
Q: Mention two functions of DNA polymerase I in E. coli replication machinery?
A: The function of the polymerase I is it removes the RNA primers from the okazaki fragments and the…
Q: Why is DNA gyrase necessary for replication?
A: DNA gyrase is an enzyme of class topoisomerase and subclass of topoisomerase type II. DNA…
Q: With regard to DNA replication, define the term bidirectional replication.
A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…
Q: If the gene for primase were mutated so that no functional primase was produced, what would be the…
A: The process of DNA replication is essential during the cell division cycle in both the eukaryotic as…
Q: how the double-helical structure of DNA suggests a mechanism for DNA replication?
A: Prokaryotes DNA replication occurs in three steps Initiation- a) Recognition of the position for…
Q: What would happen to DNA repair in bacteria if MutH is mutated such that is cannot recognize the…
A: In prokaryotes , Mut H involved in mismatch repair syatem. Mut S can recognise mismatched…
Q: hat role do deoxyribonucleotide triphosphates (dNTP) in DNA replication?
A: The process of replicating a double-stranded DNA molecule into 2 identical DNA molecules is known as…
Q: ACTIVITY 7.3.1 Given a part of DNA undergoing replication. Copy and write the corresponding bases in…
A: Replication is the process of making new DNA strands from the parent DNA by using them as templates.…
Q: If a cell were damaged, & DNA ligase could no longer be produced, how would replication be affected?
A: Each strand of DNA participates in DNA synthesis due to its double helix structure. DNA synthesis is…
Q: Show the expected labeled cleavage products if the following DNA segment were subjected to each of…
A: D.N.A. Cleavage --- A cleavage of single - stranded DNA oligonucleotides in the presence of ionic…
Q: What part(s) of a nucleotide (namely, phosphate, sugar, and/or base) is/are found in the major and…
A: DNA is a molecule that is in charge of bearing and transmitting inherited information or genetic…
Q: What are the chemical bonds of the DNA molecule that are broken for the replication process to…
A: DNA replication is a process by which a cell duplicates its DNA before its division. Replication of…
Q: Explain the effect(s) the following scenarios would have on DNA replication or translation. For each…
A: Replication describes how cells continue to divide after they have completed the process of cell…
Q: In what ways are DNA polymerase and RNA polymerase similar? How do they differ?
A: DNA and RNA polymerase are enzymes responsible for the synthesis of genetic material that is DNA and…
Q: What is bidirectional replication?
A: Deoxyribonucleic acid (DNA) replication is the biological process of producing two identical…
Q: Why do we say that DNA replication is semiconservative?
A: DNA is the chemical name for the molecule that carries genetic instructions in all living things.
Q: What is difference between the leading and lagging strands in DNA replication? Which? -Okazaki…
A: DNA replication is a process by which DNA is copied. It occurs mainly in S phase of cell cycle.…
Q: What similarities and differences exist in the enzymatic activities of DNA polymerases I and III?…
A: The process of replication in living cells requires a set of enzymes and DNA dependent DNA…
Q: If a bacterial (E. coli) cell has 50,000 bp, how long will be a normal DNA replication?
A: Different macromolecules are present in the body, and they include carbohydrates, proteins, lipids,…
Q: With illustrative diagrams, explain the three theories of DNA replication.
A: The DNA replication is the process of formation of DNA in which one strand of DNA act as the…
Q: Why does DNA replication produce two daughter strands that are identical to each other and to the…
A: DNA replication occurs in S phase. DNA replication occurs in 5’ to 3’ direction. DNA replication…
Q: Consider the following sequence of DNA: 3'-TTA CGG-5' What dipeptide is formed from this DNA after…
A: The genetic information is present in the sequences of the DNA. The sequence of DNA that runs in the…
Q: How is DNA replication initiated in prokaryotes and eukaryotes? How is this process controlled and…
A: Deoxyribonucleic acid (DNA) is the genetic material found inside a cell's nucleus. The production of…
Q: 1.1 What components must be available for DNA polymerase III to proceed with DNA synthesis during…
A: DNA replication is the process in which DNA itself act as template for the formation of DNA strand…
Q: Which statement is TRUE regarding the DNA ligase mechanism?
A: DNA ligases DNA ligases are the enzymes that are responsible for joining the two strands of DNA by…
Q: Does DNA replication follow the conservative,semiconservative, or dispersive model?
A: DNA or Deoxyribonucleic acid is a two-stranded double helix molecule which has to be perfectly…
Q: As the strands are synthesized in replication, which of the following is true?
A: The process of in which DNA molecule produce exact copy or replica of itself is known as the…
Q: How would DNA replication be affected in a bacterial cell that is lacking DNA gyrase?
A: The process of DNA replication is the process by which the genetic material of the organism copies…
Q: During DNA replication in E. coli, which enzyme forms the phosphodiester bond between an RNA primer…
A: Ligase unwinds the helical structure of DNA. Topoisomerase breaks the pressure of supercoiling in…
Q: Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents…
A: Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) Sense strand is also known as…
Q: What is one enzyme that is involved with DNA replication and how would the absence of this enzyme…
A: Introduction: Nucleic acids are major macromolecule present in the nucleus of the cell. DNA is a…
Q: Identify two important enzymes involved in replication. Where does replication occur in the cell?…
A: As there are many questions given in one, the solution is provided only to the first three…
Q: Why is it necessary to unwind the DNA helix in the replication process?
A: DNA replication is the process by which a double stranded DNA molecule is copied to produce two…
Q: If the gene for primase were mutated so that no functional primase was produced, what would be the…
A: DNA replication is the process by which new DNA strands are formed.
Q: In terms of the new DNA strands that are generated, what are the differences between replication and…
A: DNA replication is a biological process which produces two identical DNA from the one original…
Q: In what way that DNA replication in E. coli shares the profound common ground with DNA replication…
A: E. coli, as most microscopic organisms (bacteria), has a single origin of replication on its…
Q: Why must replication of DNA proceed in two opposite directions? And what differs about how DNA…
A: DNA replication It is defined as the biological process of generating two similar copies of DNA…
Q: Why do higher salt concentrations stabilize the DNA double helix? Or What aspect of the structure of…
A: DNA is the double helical structure in which both the strand are antiparallel to each other. The…
Q: Why is DNA replication is considered a semi-discontinuous process? Explain in detail.
A: Biomolecules are organic molecules present in living organisms. There are mainly four biomolecules.…
Q: What is origion of replication?
A: For the purpose of genetic information and thus chromosomal DNA transmission from one generation to…
Q: What are semi-conservative DNA replication?
A: The mechanism of DNA replication, which will occur in all cells, is called semi-conservative DNA…
Step by step
Solved in 2 steps
- The central dogma of molecular biology states simply that DNA encodes RNA, and RNA encodes protein. For each of the following processes, describe, 1) where in the cell they occur, 2) one important protein (or protein containing complex) involved 3) the result of this process. DNA replication Where?) Protein?) Result?) Transcription Where?) Protein?) Result?) Splicing Where?) Protein?) Result?) Translation Where?) Protein?) Result?)a) One DNA strand of Chromosome #12 has the following nucleotide sequence: TAC/CGC/CCT. What nitrogenous bases would be found on "the other DNA strand lying alongside of it?" b) Which nitrogenous bases would be found on the MRNA (Messenger RNA) transcribed from a DNA strand with the following nucleotide sequence: AAA/TTT/GGG/CCC?Assume the following DNA template strand: 3'-ATA GCG AGG AGT ATC-5' A) What would be the protein associated with this DNA template strand? Give the sequence of amino acids encoded by this fragment. Leave traces of your steps. B) In the synthesis of this protein, what are the codon and the anticodon for? Explain in one sentence for each. C) We find, in another cell, a mutation of this DNA template strand: 3' ATA GCG TGG AGT ATC-5’ 1. What type of point mutation is it? 2. Did this mutation arise during transcription, translation or DNA replication? D) If this mutation is found in a spermatozoon, will it have an effect on the individual, its offspring or both? Briefly explain
- Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence? b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence? c) What would be the other strand of DNA?How does the cell ensure that a specific amino acid (say, valine) attaches itself only to the one tRNA molecule that is specific for valine? (A) Proteins called aminoacyl DNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct DNA molecules carrying the right anticodon. (B) Lipids called aminoacyl tRNA synthetases are responsible for bringing together the proper pair. The lipid binds the amino acid and one of the correct tRNA molecules carrying the right codon. (C) Enzymes called aminoacyl tRNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct tRNA molecules carrying the right anticodon. (D) Enzymes called peptidyl mRNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct mRNA molecules carrying the right anticodon.A segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What sequence of bases would appear in mRNA transcribed from this segment? b) Assume the first base in this mRNA is the beginning of a codon. What order of amino acid would be translated into a polypeptide synthesized along this segment? c) Give anticodons for each tRNA associated with the translation in part (b)
- The following sequence represents a few codons present in one strand of DNA.Using this strand of DNA as a template strand for transcription, you are required to synthesize a new RNA strand. A) Show the codons that will be present on the RNA strand. B) Using the universal genetic code, provide the amino acids on the protein that will be translated from the RNA strand. 3’ TAC ATG GTT GTG CTA ATT 5’The following diagrams represent DNA molecules that are undergoing replication. Draw in the strands of newly synthesized DNA and identify (a) the polarity of the newly synthesized strands, (b) the leading and lagging strands, (c) Okazaki fragments, and (d) RNA primers.(a) Write the DNA double strand. (b) Assuming the gel pattern represents the template strand, transcribe and translate the DNA. (c) Write the anticodon sequence. A G 2nd (middle) Base of a Codon 1* 3rd U A G Base Base UUU - Phe U UUC - Phe UCU - Ser UCC - Ser UAU - Tyr UAC - Tyr UGU - Cys UGC - Cys UUA - Leu UCA- Ser UAA - STOP UGA - STOP UUG -Leu CUU - Leu CUC - Leu UCG-Ser CCU - Pro CCC- Pro UAG- STOP CAU - His САC - His UGG- Trp CGU - Arg CGC - Arg CGA - Arg CGG- Arg CỦA - Leu ССА-Pro CAA - Gin CAG- Gin AAU - Asn CUG - Leu CCG-Pro AUU - Ile ACU - Thr АCC - Th ACA - Thr AGU – Ser A AGC - Ser AGA - Arg AGG - Arg GGU - Gly GGC - Gly GGA - Gly GGG - Gly AUC - lle AAC - Asn AAA - Lys AAG - Lys GAU - Asp GAC - Asp GAA - Glu AUA- lle AUG - Met ACG - Thr G GUU - Val GCU - Ala GCC - Ala GUC - Val GUA- Val GCA - Ala GUG - Val GCG - Ala GAG - Glu PUAGPCAGUCACUCAG |
- a) What dipeptide is produced from the following segment of DNA: AGAGAT? (b) What happens to the dipeptide when a point mutation occurs and the DNA segment contains the sequence ATAGAT instead?Spontaneous deamination of cytosine bases in DNA takes place at low but measurable frequency. Cytosine is converted into uracil by loss of its amino group. After this conversion, which base pair occupies this position in each of the daughter strands resulting from one round of replication? Two rounds of replication? (a) How many different 8-mer sequences of DNA are there? (Hint: There are 16 possible dinucleotides and 64 possible trinucleotides.) We can quantify the information- carrying capacity of nucleic acids in the following way. Each position can be one of four bases, corresponding to two bits of information (2² = 4). Thus, a chain of 5100 nucleotides corresponds to 2 × 5100 = 10,200 bits, or 1275 bytes (1 byte =8 bits). (b) How many bits of information are stored in an 8-mer DNA sequence? In the E. coli genome? In the human genome? (c) Compare each of these values with the amount of information that can be stored on a computer compact disc, or CD (about 700 megabytes).A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications? b) Write the amino acid sequence of your mature mRNA. c) List the molecules involved in translation and briefly describe their function.