A child weighs 55 lb. The order reads 25 mg/kg/day of erythromycin to be given every 6 hours. You have a bottle of erythromycin that is 62.5 mg/5 mL. How many mL in one dose?
Q: Which of the following occurs when red blood cells are transferred from an isotonic solution to a…
A: The "tonicity" of solution refers to the concentration of solute and solvents in it. A solution is…
Q: Which of these activities, that results in energy expenditure, makes up the greater portion of…
A: Introduction In the body, energy is used in a variety of ways. To carry out vital tasks such…
Q: Where in the body does most digestion occur? a. mouth b. stomach c. small intestine d. large…
A: Digestion is the complex process of converting the food you eat into nutrients that your body can…
Q: This type of cell transport happens during secretion of hormones, neurotransmitters and digestive…
A: The movements of biomolecules take place from one site to another in the body. There are different…
Q: If two different organisms are closely related evolutionarily, then they will (a) be similar in…
A: Any accumulated or cumulative change in an organism's or population's features over a long period of…
Q: In ______, the gene product can be increased by increasing the number of genes available for…
A: Introduction When the genetic material or DNA sequence is exchanged or rearranged between different…
Q: Illustrate how gene flow works and how it may inhibit evolution.
A: Gene migration is another name for gene flow. The movement of genetic material from one group to…
Q: A. Predict the pressure of nitrogen gas at T =-98 K and v=0.00375 m³/kg on the basis of (a) the van…
A: The symbol p or P is typically used to indicate pressure. It will calculate the force per unit area…
Q: Compared to fat, muscle is: a. Denser and less metabolically active b. Denser and more…
A: Muscles Muscles are the soft tissue that help in the movement of body.
Q: Why can the Chelex solution extract DNA in just one step?
A: Introduction The principle of Chelex extraction prevents DNA degradation from the degradative…
Q: Sickle cell anemia affects red blood cells by causing them to delivered efficiently to all parts of…
A: Red blood cells are present in the plasma of blood. The blood is a specialised connective tissue. It…
Q: Name the physiological systems used to control the function of physically distant organs/tissues?…
A: Physiological system It is the system of our body that performs the major work like digestion,…
Q: Which of the following statements is NOT TRUE about membrane transport? to facilitate movement of…
A: The plasma membrane is permeable only to certain molecules. This means that the membrane allows some…
Q: How does bulk transport of molecules governed in a eukaryotic cell? by active transport by…
A: Bulk Transport Across Cell Membranes Bulk transport inwards as well as outwards occurs across the…
Q: If a polymorphism is found at a low frequency globally, but has a high frequency in a particular…
A: Polymorphism:- it represents the two or more than two variants of a particular DNA sequences or gene…
Q: Which of the following most likely has a sequence of hydrophobic amino acids that permits the…
A: Correct answer: (a) Translocator (TIM/TOM) The transport of proteins inside the mitochondrial…
Q: Estimate the chronic daily intake of 1,1,1-trichloroethane from exposure to a city water supply that…
A:
Q: Instructions Match the letters that describe the process with the numbers in the Venn Diagram. Each…
A: Here are the matches
Q: Parathyroid hormone and calcitonin are hormones that work antagonistically. Two other hormones that…
A: Introduction : Chemicals called hormones serve as the body's primary messengers. The endocrine…
Q: 1. You accidentally used safranin as the primary stain and malachite green as the counter stain…
A: A stain is a chemical substance used in the laboratory to add color to the cell. This is used for…
Q: The action potential generated in the squid giant axon requires voltage-gated potassium channels.…
A: * Voltage gated potassium channels are transmembrane proteins that opens in response to…
Q: Can we use biogeographic evidence to support evolution without using fossil evidence? Give examples
A: Introduction Evolution is the critical phenomenon that regulates the survivability and continuity of…
Q: Which of the following F2 phenotypic ratios show codominance? Assume you are starting with a…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: What is BIODIVERSITY AND EVOLUTION? And what are the possible questions, quizzes to be asked for…
A: Introduction: The process of life's evolution on Earth has not been straightforward. Some describe…
Q: What is the function of NEU?
A: An oncogene is a mutated gene with the ability to cause cancer.
Q: What are some other prezygotic reproductive barriers besides a mating dance?
A: Reproductive isolation is necessary for organisms to separate from their shared ancestors and propel…
Q: Being able to repair old cells, build new cells and structures like the mitochondria you need energy…
A: Introduction Any organic, living system that performs as a single entity is referred to as an…
Q: genotype cannot be determined QUESTION 2 Suppose that extra fingers and toes are caused by a…
A: Introduction: Any one of two or more genes that may alternately appear at a specific location…
Q: species are most broadly distributed, which have the smallest range? List at least 3 names per each…
A: Species of organisms are distributed worldwide according to their adaptation ability and the…
Q: Which of the following subcellular structures facilitates intracellular transport?
A: The research of structure and function of cells is known as cell biology, and it is based on the…
Q: DNA sequences were analyzed from humans and three other mammals: species X, Y, and Z. Which of these…
A: DNA is stands for deoxyribonucleic acid. DNA is genetic material that is present in each cell of…
Q: Explain the steps in vesicle docking and fusion • What proteins are involved? What are their…
A: The science of cell structure and functioning is known as cell biology, and it is based on the idea…
Q: Gel Running Buffer is made and kept at 14X concentration for storage. We will need 1.5 L of this…
A: Electrophoresis is a technique in which desired molecule is seperated when electric field is applied…
Q: During gestation, female rats were treated with oestrogen. What effect will this have on their…
A: According to the classic view of sexual differentiation, the differentiation of sex occurs in the…
Q: QUESTION 4 Although physical features such as teeth are good for classification, only DNA can be…
A: Introduction : A phylogenetic tree, also known as phylogeny, is a picture that shows how different…
Q: Different recommended BMI ranges exist for people of different ethnic groups. This is partially due…
A: Answer : True
Q: This type of cell transport does not require energy for the molecules to be transported. Passive…
A: Passive Transport Movement of molecules across cell membranes which requires no metabolic energy and…
Q: How do SSRI and MAOIs work? Which parts of the neural communication machinery do they target? Which…
A: SSRI and MAOI are the strong classes of anti depressants. SSRI is serotonin reuptake inhibitors MAOI…
Q: Compare and contrast the operation of Optical microscopy and TEM in terms of Contrast (explain all…
A: Microscope is an optical instrument that is used to see microorganisms or very tiny objects which we…
Q: Most restriction enzymes (RE's) were isolated from bacteria. Since these bacteria require an intact…
A: Restriction endonucleases are specific enzymes that cleave the DNA sequence by recognising and…
Q: What are the characteristics of a high-quality DNA extract? What do you do to determine the quality…
A: DNA extraction is a protocol used for the isolation and purification of DNA from biological samples…
Q: Two goats are mated together. One is tall and brown and of unknown genotype. The other is a short…
A: Introduction : A test cross is defined as a cross which is used to test whether an individual is…
Q: Remove codons 24 to 66, inclusive AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGU
A: GENETIC CODE The genetic code is the relationship between the sequence of bases in DNA and the…
Q: (c) As for the vectors to be used for cloning and expression, suggest two types of plasmids suitable…
A: Genetic engineering has the ability to enhance the flavor of meals, boost nutritious value, and even…
Q: Which group (Population A that stayed in the flat territory or Population B that moved to the rocky…
A: Genes are the hereditary units that control specific traits, different versions of these genes are…
Q: Which of the following pathways would you expect to be inhibited by drugs that prevent import of…
A: Explanation: Since the import of proteins into the nucleus is part of the TGF-Beta signalling…
Q: Which of the following helped to lay the groundwork for understanding the record of historical…
A: The Earth was created by deposition from the solar nebula approximately 4.54 billion years ago,…
Q: Why do water-dwelling animals have thicker bones than land-dwelling animals?
A: Bones are the organs of support and form the part of skeletal system. These maintain the body shape…
Q: The diagram represents a possible phylogenetic tree showing the relationship between the four…
A: The phylogenetic tree is the diagrammatic representation of the evolutionary relationship of the…
Q: Write a note on fat soluble vitamins
A: Introduction A vitamin is an organic substance that is required in trace levels for good nutrition…
A child weighs 55 lb. The order reads 25 mg/kg/day of erythromycin to be given every 6 hours. You have a bottle of erythromycin that is 62.5 mg/5 mL. How many mL in one dose?
Step by step
Solved in 3 steps
