8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for creating the MRNA. Write the corresponding mRNA 5' 3' and translate this mRNA into protein. DNA 3' СCGTGAATАCGCTACGGAАСТСАСТGGTА 5' DNA 5' GGCACTTATGCGATGCCTTGAGTGACCAT 3' MRNA 5' Protein Alanine Tyrosine A Stop Valine GU Cysteine G Stop Tryptophan Arginine G AC U Serine Leucine Lysine Proline Asparagine GACUGACU Serine opusol Histidine Threonine
Q: When 1.6 million year old Nariokotome/Turkana skeleton was recovered near Lake Turkana in Kenya.…
A: This shows that the discovered skeleton was a preadolescent.
Q: The majority of the body's water can be found A Blood plasma water B Intracellular water Urine D…
A: 7. Intracellular fluid makes up the majority of the water in the body. The interstitial fluid, which…
Q: Which antibiotic is part of our innate immune system? Group of answer choices trimethoprim…
A: Lysozyme are the Type of enzymes which are found in tears, milk and saliva. These lysozyme kill…
Q: What is meant by the overload principle? A. Stretching a muscle group beyond the joint's range of…
A: To develop any area of physical fitness, the overload principle states that the person must…
Q: The medical practice you're working for testing an average of 22.4 patients a day for the past 3…
A: Medical practice: A sole proprietorship, a partnership, an association, a professional corporation,…
Q: focusing on the involvement of epigenetic regulation in learning and memory.
A: Epigenetics Epigenetics deals with the study of changes in phenotypic traits that are not due to…
Q: DATAAND RESULTS: A. Description and source of isolates Nudeic Acid Source Description BANANA DNA…
A: All living things, including bananas and humans, pass on information from generation to generation…
Q: ➢ Is the tripartite body plan of phoronids advantageous for them? Why or why not? ➢ Why is the…
A: Phoronids Phoronids are also known as horseworms. These are small marine organisms of the animal…
Q: What is structural variation of genomes? Describe the mechanisms that create structural variants,…
A: Structural variations are referred to variation or difference in the structure of chromosome of…
Q: Draw how the signals are traveled through the nervous system
A: Nervous tissue is the tissue that allows the propagation of electrochemical signals as nerve…
Q: need help finding the right answers there are mutiple answers please
A: In a coelomate, the lining of GI is different from the lining of internal organs and hence the first…
Q: Based on your knowledge of oxidative phosphorylation, answer the following questions: a) Suppose you…
A: The mechanism through which ATP generation is linked to electron transportation along the…
Q: _________ is the greenhouse gas produced by anaerobic bacteria in irrigated rice agroecosystem. 2.…
A: Carbon dioxide, methane, nitrous oxide, flourinated gases are examples of greenhouse gases.…
Q: missense mutation will influence the tertiary or quaternary structure of the protein (FGFR3). How…
A: Missense mutation A missense mutation specifically defines the kind of point mutation in which the…
Q: What are the complections Of tooth extraction?
A: Introduction The removal of a tooth is known as tooth extraction. "An ideal tooth extraction is…
Q: One of the leading theories for the origin of SARS-CoV-2 in hiumans is that it originated via a…
A: According to our policy, only the first three questions of a multipart question could be answered in…
Q: why do some rats succesfully learn the moris water maze and some dont. These rats over a large…
A: Morris water maze test is a test commonly used test to study spatial learning and memory in animals,…
Q: Which of the following is a Phase II reaction? A Dehalogenation B Reduction c) Oxidation Glutathione…
A: ANSWER;-D) Glutathione conjugation. Explain;- Phase II reactions consist of adding hydrophilic…
Q: Where is dentin matrix phosphoprotein expressed?
A: Dentin is mostly made up of hydroxyapatite crystals that are suspended in an organic matrix. This…
Q: Label the visible parts of mung bean and corn seedlings
A: The embryo, endosperm, and seed coat are the three main components of a seed. Before it develops…
Q: Experiment Title : Surface Modification of poly(vinylidene fluoride) (PVDF) membranes with untreated…
A: Introduction Antibacterial generally refers to an antibiotic, which is a type of antimicrobial agent…
Q: Analyze the graphs below. Which growth model (exponential or logis- tic) would apply to a population…
A: Population growth Population growth can be defined as the increase in the number of organisms in a…
Q: The following are critical factors for bacteria to survive EXCEPT? A. Appropriate temperature B.…
A: Bacteria can survive in temperatures that are hotter and colder than mammals, but they thrive in a…
Q: What role does the human microfauna play in protecting humans against pathogens? (At this point in…
A: The human host and its microbial flora form a complex ecosystem whose balance is a striking example…
Q: __________ are composed of a single linear (unbranching) chain of covalently bound amino acids.…
A: Amino acids are known as the building blocks of protein. These are organic compounds mainly composed…
Q: Which is common between aerobic respiration and anaerobic respiration ? (A) Similar substrate (B)…
A: Introduction - Respiration can be divided into two categories: Respiration that occurs in the…
Q: What is the problem in the article "Stopping pandemics before they start: Lessons learned from…
A: Introduction Pandemics:- It is the worldwide spread of a new disease, it is an outbreak of disease…
Q: Which one of the following organelles is considered as the "energy producing" centre of the cell? A.…
A: Introduction - Cellular respiration is a series of metabolic reactions and activities that occur in…
Q: When chlorophyll is burnt which element is obtained ? (A) Ca (B) Na (C) Mg (D) Mn
A: Introduction - Chlorophyll is a group of similar green pigments found in cyanobacteria's mesosomes…
Q: Discuss the THREE (3) main stages crucial to microbial leaching of copper from a low-grade ore,…
A: Bioleaching involes microorganisms .Main copper minerals include sulfides, (CuFeS2) chalcopyrite,…
Q: produced by a bird that flies.
A: Example of flightless birds that cannot fly are ostrich, Kiwi and emu. The birds that are able to…
Q: Iron deficiency results in- (A) Leaf tip necrosis (B) Small leaves disease (C) Decreased protein…
A: Introduction - Iron is a key component of electron chains and a cofactor in a number of important…
Q: What is the article "Stopping pandemics before they start: Lessons learned from SARS-CoV-2" about?
A: Introduction SARS-CoV-2 is a member of a large family of viruses called coronaviruses, This virus…
Q: Where do invertebrates fit into the evolution history of eukaryotes? Of animals?
A: The study of relationships between distinct groups of species and their evolutionary development is…
Q: Order the events leading to the formation of urine in the bladder. Question 106 options:…
A: Urinary bladder The bladder or urinary bladder is appear shaped triangular hollow organ located…
Q: 5. View the protists blood parasites (Trypanosoma cruzi, Trypanosoma brucei, and Plasmodium vivax).…
A: Trypanosomes are zooflagellate protozoans that are obligate parasites that can cause parasitic…
Q: In Mendel’s terminology, a “true-breeding” variety of a particular plant: a. Has a homozygous…
A: Introduction Breeding is the sexual reproduction of animals or plants that results in progeny. It…
Q: Lacl gene product is or does all of the following except A regulates expression of Lac ZYA B is a…
A: LacI is one of the genes present in Lac operon which codes for a lac repressor. This lac repressor…
Q: The two primary types of toxins associated with foodborne illness affect the ? A. Nervous system…
A: Introduction :- The gastrointestinal tract is the digestive tract or passageway that connects the…
Q: chymotrypsin
A: Chymotrpsin: It is a digestive enzyme which breaks down polypeptides. It consists of a catalytic…
Q: To explain: The reason of plant wilting using cohesion theory of water transport.
A: Plant withering is the phrase for when a plant loses its firmness. Because of a decrease in the…
Q: What are the importance of molluscs to other organisms, environment, medicine, etc.?
A: Introduction Mollusca is the second-largest phylum of invertebrate organisms after Arthropoda, with…
Q: Why is COVID 19 and getting the vaccinated important, citing from a source?
A: NB: for your kind knowledge, according to Bartleby rules and regulations we can't mention…
Q: Hello I'm a food technology student and I have a question about this matter its about this…
A: Food defects means the defects during processing or packaging. Packaging defects also affects the…
Q: Why do cells need to be kept in the freezing devices first then transferred to liquid nitrogen…
A: Rapid freezing of cells can cause ice crystals large crystals can be formed in which cells are…
Q: 7) This refers to the pattern being followed by the arrangement of an animal's body parts. 8) This…
A: The organisms are classified into three categories based on symmetry - Assymetric Radially…
Q: Please solve and answer in complete sentences. (thank you) Sequence divergence vs conservation for…
A: The exons are the type of sequences that are utilized after the processing of the mRNA is complete.…
Q: Explain, in detail, how tyrosine kinase proteins are involved in one signal transduction pathway of…
A: The signal transduction pathways in cell occurs via three types - G protein couple receptors,…
Q: How are biogeochemical cycles interconnected
A: Introduction :- A biogeochemical cycle (or, more broadly, a matter cycle) is the process through…
Q: What regions of the skeleton may be most useful for determining the sex of the individual from the…
A: Ans is- PelvisIn
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?Answer the following whether it is TRUE or FALSE: 1. For each DNA segment 3'-ACCTGCCTACCCG-5' the sequence of the mRNA molecule synthesized is 5'-TGGACGGATGGGC-3' 2. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-ATGGCTCCATACATG-3'. 3. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-AUGGCUCCAUACAUG-3'. 4. The template strand is the strand of DNA used for RNA synthesis. 5. Transcription forms a messenger RNA molecule with a sequence that is identical to the DNA template from which it is prepared.Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
- www D le C 3⁰ A B Indicate True (T) or False (F) for the following statements. Only use the letter (T/F) in the space provided 1. The name of this process is best known as Rho dependent termination 2. The enzyme C called DNA polymerase incorporates ribonucleotides into B called the mRNA False 3. The DNA region A contains inverted palindrome sequences which results in formation of a stem-loops structure 4. During this process, the structure D called terminating hairpin forms and increases the enzyme affinity which terminates transcriptionpcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-Tyr
- Molecule Sequence Hb A DNA 5’ GGC AGA CTT CTC CTC AGG AGT CAG GTG CAC 3’ Hb A mRNA Hb A protein Hb S DNA 5’ GGC AGA CTT CTC CAC AGG AGT CAG GTG CAC 3’ Hb S mRNA Hb S protein transcribe and translate each sequence making the mRNA and protein sequence of eachthank you5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3' 3' CACGATCGCCCTTACTCGACCCTATGATCATCCCGA 5' Template Strand: 9. Using the template strand, transcribe the DNA above, Be sure you write your sequence 5 - 5 a indicate the 5' and 3' ends of any nucleic acid molecule(s). 10. Use the codon chart below to translate your mRNA into an amino acid sequence. Begin at the first codon. Third First position (5' end) Second position position (3'end) UGU Cys UAU Tyr Cc UGC Cys UGA Stop UGG Trp UCU Ser -Y UAC Tyr UAA Stop UAG Stop UUU Phe - F UUC Phe UUA Leu UUG Leu FL UCC Ser -- UCA Ser UCG Ser CGU Arg CGC Arg ER CGA Arg CGG Arg CCU Pro CAU His CUU Leu CUC Leu -- CAC His CAA Gln CAG Gln CCC Pro -P A - CUA Leu CUG Leu CCA Pro CCG Pro AAU Asn AAC Asn AGU Ser AGC Ser AGA Arg ACU Thr AUU lle AUC lle AUA lle AUG Met M ACC Thr -T ACA Thr ACG Thr A. AAA Lys K AAG Lys -R AGG Arg A. GAU Asp -D GAC Asp GGU Gly GGC Gly GCU Ala GUU Val GUC Val GCC Ala A -G GGA Gly GGG Gly A -V GUA Val GUG Val GCA Ala GCG Ala GAA Glu -E…
- 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…5' AGGGUUUGGGAUGAAUCGACGACGAUCCUACGUACUAAGUA 3' Write the amino acid sequence for this portion of the coding sequence: Write the double-stranded DNA sequence that corresponds to the MRNA above. Label 5' and 3' ends. Would transcription have occurred using the top or bottom strand as the template? Imagine you discover a mutation in the DNA, within the coding sequence of the corresponding mRNA above. You determine that the mutation does not result in a change to amino acid sequence. What is the most likely reason for this?Consult the DNA below. Only one strand is shown (the complementary strand is not shown). What 2 aspects can you observe in this animal DNA that indicates that it is the regulatory part of a eukaryotic transcription unit? (The spaces are added to make the sequence easier to read). AGAGGGCGGT CCGTATCGGC CAATCTGCTC ACAGGGCGGA TTCACACGTT GTTATATAAA TGACTGGGCG TACCCCAGGG TTCGAGTATT CTATCGTATG GTGCACCTGA CT..................