Q: • (Insert role/function #1) (Insert role/function #2) • (Normal human RBC range million cells/uL)…
A: Answer
Q: A codon that specifies the amino acid Gly undergoes a single-base substitution to become a nonsense…
A: Information in the gene tell the cell to make a particular protein. This information is encoded in…
Q: Explain the equation E+S---->ES----> E + P.
A: Given equation, E+S---->ES----> E + P E = Enzyme S= Substrate P= Product Enzyme is required…
Q: Antibody Panel: MNS e f M N S + + + + 0 0 0 + 0 + + + + + 0 + + + + + 0 + + + + + + + + + 0 8 00 0 +…
A: Step 1: Antibody screening for red blood cells (RBC) is done to test the presence of RBC antibodies…
Q: 32. Serum difars from blood In tal kacking globulins (b) lacking albumins (c) lacking clotting…
A: Blood is a body fluid that transports oxygen and nutrients to the cells and carries away carbon…
Q: Q:-What is a xaxim?
A: Introduction In this question we have to discuss about the xaxim.
Q: O 3'-GTA-CAG-CCG-CGT-5' ) 5'-CAC-GUC-GGC-GCA-3' 3'-CAT-GTC-GGC-GCA-5"
A: His-Val-Gly-Ala His= CAC Val=GUC Gly=GGC Ala=GCA these amino acids get coded by other codes too,…
Q: In (b), why would it be more efficient to use labeled anti-human IgG rather than label the patient’s…
A: In direct method of antigen detection, the primary antibody is directly attached to a label. It…
Q: his člašš of antibody is a pentamer. . O a. IgG O b. IgE Oc IgD
A: Answer. Antibodies, the antigen binding glycoproteins are synthesized exclusively by B cells in…
Q: DNA Standard Markers A --- Control DNA 4282 Patient Peripheral Blood DNA 4282 3000 1282 D Patient…
A: Blood From peripheral, tumor and breast samples all have its own genetic identity or fingerprint…
Q: HindII --- 5' GTC - GAC 3', HaeIII --- 5' CC - GG 3', EcoRI --- 5' G - AATTC 3' and BamI --- 5'…
A: Restriction enzyme varies from one other in their restriction sites as well as the type of ends they…
Q: B+ АВ- anti-A anti-B anti-Rh AB+ А- anti-A anti-B anti-Rh A+ anti-A anti-B anti-Rh O- O+ anti-A…
A: Blood is a liquid substance which flows in the blood vessels and carry nutrients and oxygen to the…
Q: difference between sars cov 2 and B117 variant
A: Covid 19, was first detected in the Wuhan province of China around December 2019. It has since…
Q: 1) Which other complement complex has hon a) MBL complexed with MASP1/2 (c) C5a6789 b) Pentameric…
A: Complement system is designed of a huge number of plasma proteins that react with one another. This…
Q: 3. Artificial serum containing media contains ------% serum in it.
A: Cell growth media Growth media is the artificial media that is enriched with all necessary…
Q: Write net ionic equations for the following reactions:
A: An ionic equation is a type of chemical equation in which the ionic compounds are expressed as ions…
Q: anti-Rh serum anti-A serum anti-B serum Blood Testing Results for Driver of Car The spot plat above…
A: Introduction Blood Typing Is A Technique For Determining Your Blood Type. Blood Typing Is Done To…
Q: nstant antigen ndependent antigen ependent antigen
A: Antigen is a molecule which arouses an immune response usually in the form of antibodies in the…
Q: Hi A higher than normal white blood cell count usually means you have some type of infection.but…
A: COPD or chronic obstructive disease is one of the most painstaking diseases that can affect humans…
Q: जन्का ली देकर परार देेल लब्पsogene sn जाक ? A) Hn iso2gme cam be Coeed 0Siलह कसक्ट कर Te १riance…
A: Enzymes are the protein molecules that increase the rate of reactions by decreasing the activation…
Q: Blood Which Has: Blood Type(s) Antigen A only Antigen B only Antigen A and B No Antigen A or B
A: Blood is classified into different groups according to whether certain substances are present or…
Q: 4 ree floating MHCII
A: As we know The proteins that bind to the body's foreign invaders are known as antibodies in the…
Q: 4. 21 Directions. Based on the given clue in the left table, write the correctname of the…
A: A single gene mutation (monogenic disorder), numerous gene mutations (multifactorial inheritance…
Q: A G UUU Phe UCU U UUC UUA UUG UAU UAC UAA UAG UGU Cys U UGC Stop UGA Stop A Stop UGG Trp G Tyr UC…
A: The term protein is associated with a biomolecule form that gets generated after the polymerization…
Q: - Trp G CCU Pro CAU - His CGU - Arg U CUU Leu CUC Leu CCC Pro CAC- His CGC - Arg C CUA- Leu CCA Pro…
A: A mutation occurs when the nucleotide sequence of an organism, virus, or extra - chromosomal DNA is…
Q: thromboembolism is the rare .35 form of emboli TO F
A: Thrombus It is the formation of blood clot in the vascular system. Emboli It can be any particle…
Q: character of blood flukes
A: Blood are parasitic flatworms. The scientific name of the Blood fluke is Schistosoma. They can…
Q: Diagram 10.2 shows defence mechanism P and Q which occur in the body to fight invading pathogens.…
A: Immunity is defined as the capacity of the body to resist pathogenic agents. The immune system is…
Q: For all compatible blood transfusion scenarios, put an x in the box below. Donor О- В- B+ А- A+ AB-…
A: Blood Groups and Compatibilities There are many blood bunches in the human populace including ABO,…
Q: On RBC cell surfaces, ABH antigens are O a. Glycolipids O b. Glycophorins C. c. Glycans Od.…
A:
Q: Blood type RBC Antigen Plasma Antibodies A-negative AB-negative A-negative B-positive O-positive
A: The ABO blood types were first discovered by an Austrian Physician Karl Landsteiner.
Q: Lucy does not have enough white blood cells for her immune system to fight infections. Was this…
A: In physiology, white blood cells are defined as the leukocytes or leucocytes cells of the immune…
Q: Why is the one hour bundle in sepsis protocol called the one hour bundle?
A: Sepsis is a life-threatening condition that is manifested by numerous signs, symptoms, hemodynamic,…
Q: Anti-A Anti-B Anti-Rh Blood Type Slide #1: Mr. Smith Agglutination No…
A: The "ABO" blood group system is made up of four blood groups – A, B, AB, and O and is based mostly…
Q: Homogeneous Immunoassay (HIA) Principal
A: An immunoassay is a biochemical test which measures the concentration of macromolecules or small…
Q: 3 difference between sars cov 2 and B117 variant in relation to their molecule
A: An epidemic is defined as "a global epidemic, or a very large area, crossing international borders…
Q: write the DNA complement for 5'-ACCGTTAAT-3'
A: DNA is double-stranded.
Q: Good match?| notype AA antigens A antigen genotype Bi Antibodies Anti-A No AJA ii AIB AIB ii AIB AB…
A: Blood group O- is universal donor because it has no antigen for blood group. Hence, it will not…
Q: What is the main advantage of using YACs, BACs, and PACs?
A: Recombinant DNA technology is a technique through which the desired gene of interest or a piece of…
Q: Second base G UGU A UUU Phe UUC UAU Tyr UACJ UU Cys UCC UGC Ser UUA Leu UUG UAA Stop UGA Stop UAG…
A: According to guidelines we have to answer first question only. please kindly post the remaining…
Q: Molecular detail of D614G strain of SARS CoV-2
A: Severe acute respiratory syndrome coronavirus 2 (SARSCoV-2) is a virus that causes COVID-19…
Q: Second letter C UUU Phe UCU1 UCC UCA UCG UAU UGU) UAC Tyr UGCCYS Cys UUC UUA UUG. Ser UAA Stop UGA…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: UUU UUC UUA UUG UCU UCC UCA UCG UAU UAC UAA Stop UGA Stop UAG Skop Phe UGU UGC Ser UGG Trp CUU CUC…
A:
Q: Decoding a DNA Message 1. CGA ACT AGA TAA CCC TTA TAG AAA TAT ACA CGC TTG TGA AAC ATA ATC CGG CTG…
A: central dogma carries the message present in DNA covert into mRNA code and finally decoded into…
Q: Identify the following table. List the salient features (5-6) of this table.
A: Amino acids are organic compounds that contain amine and carboxyl functional groups, along with a…
Q: The following nucleotide sequence is found on the template strand of DNA. First, determine the amino…
A: Genetic code is the set of rules used by living cells to translate information encoded within…
Q: Luciferase (RLU) (RLU) Infectivity (RLU) VSV-G SF162 LAPTMS LAPTM5 Mock AD8 LAPTMS Mock Mock 89.6…
A: The Vif, Nef, and Vpu are the accessory proteins produced by HIV-1 that counteract the inhibitory…
Q: SARS-Cov-2 : How does it cause disease?
A: SARS-Cov-2 is a severe acute Respiratory syndrome Corona virus. This syndrome is an emerging…
Q: Write the DNA complement for 5’-ACCGTTAAT-3’. Be certain to label which is the 5’ end which is the…
A: Deoxyribonucleic acid or DNA is a bio macromolecule which is responsible for the transfer of…
Q: Patient Testing Solution (Mr. Smith) Antibody-A Antibody-B Antibody-Rh Reaction Phenotype (Blood…
A: Blood group follows multiple allelism. There are more than two alleles that determine blood type.
Step by step
Solved in 2 steps
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?Given the following stretch of mRNA, what would be the sequence of the corresponding non-template DNA? 5' - UUG-CAA-UCG-CAG-UGC-CGC-AUA-GAU - 3' Group of answer choices 3' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 5' 5' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 3' 5' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 3' 3' - AAC-GUU-AGC-GUC-ACG-GCG-UAU-CUA - 5' 3' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 5'The sequence of part of an mRNA transcript is What is the sequence of the DNA coding strand? 5'- 5' - AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG - 3' 5'- ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGAG What is the sequence of the DNA template strand? TACCCCTTGTCGTTCTCACCCCGGGACAGGTTCCTC Incorrect -3' -3'
- Below is a double stranded DNA that contains an ORF. Identify the ORF and in the spaces below, first provide the mRNA sequence that would result (in the 5' to 3' direction). Then give the protein sequence this mRNA would encode (in the N to C direction using the 3-letter abreviations and a single space in between). 5'-CTGCGC TAGGCGCAGTAGGGCATCCCACGACA-3' 3'-GACGCGATCCGCGTCATCCCG TAGGG TGC TGT-5' Codon Table: บบบ UUC JUA UUG CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val mRNA sequence: UCU UCC UCA UCG protein sequence: CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala UAU UAC UAA UAG CAU CAC CAA CAG Tyr Stop GAU GAC His Gin AAU Asn AAC AAAG} LUS Asp GAA GAG} Glu UGU Cys UGC UGA Stop UGG Trp CGU CGC CGA CGG AGU AGC Arg Ser AGG} Arg GGU GGC GGA GGG (DO NOT include the 5' and 3' numbers or the N and C. Write only the nucleotides and the abreviations for the amino acids. Include no spaces in the mRNA and a single space in between the amino acid…Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’
- Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment? Q) Would there be an effect on translation of changing the fourthT in the template strand to a C? If so, what effect?Give only typing answer with explanation and conclusion which of these choices represents one possible corresponding mRNA sequence that can be transcribed by RNA polymerase, and later translated by ribosomes from the following DNA template? 5'- CTGTATCCTAGCACCCAAATCGCAT - 3'; A. 5'- CTA GCA CCC AAA TCG CAT TAG - 3', B. 5' - AUG CGA UUU GGG UGC UAG - 3', C. 5' - AUG CGA UUU GGG UGC - 3', D. 5- ATG CGA TTT GGG TCG TAG - 3'Answer the following whether it is TRUE or FALSE: 1. For each DNA segment 3'-ACCTGCCTACCCG-5' the sequence of the mRNA molecule synthesized is 5'-TGGACGGATGGGC-3' 2. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-ATGGCTCCATACATG-3'. 3. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-AUGGCUCCAUACAUG-3'. 4. The template strand is the strand of DNA used for RNA synthesis. 5. Transcription forms a messenger RNA molecule with a sequence that is identical to the DNA template from which it is prepared.
- What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'Use a codon chart determine the amino acid sequence. Remember to read through the strand and ONLY start after the promoter and STOP when it tells you to stop. Follow example below: Example: DNA AGA TATA TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA O protein AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG start-glu-ala-thre-hist - asp-glu-threo-stop met DNA CCT ATA TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC mRNA DGGA UAU) AUG uGul Gcc nccl cAul GCol protein ly Tur MeT cys AlA ser HIJ Ala 2 3 4 DNA AGA ACT ATA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA protein DNA TAT ATAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC mRNA protein D DNA TAA ACT ATA TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA protein Auu UGA UAU AGU GAUCGA AUC MAG Auu AAU leu Stop. TRY-Met-Asp- ARG-Isle-Stop-Ile. Asn DNA CTA TTT ATA TAC TAG AGC GAA TAG AAA CTT ATC ATC mRNA protein D DNA CAT ATA TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG…Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:5’-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’(a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment? (b) Find the initiation and stop codons in this mRNA. (c) Would there be an effect on translation of changing the fourth T in the template strand to a C? If so, what effect? (d) Would there be an effect on translation of changing the fourth A in the template strand to a C? If so, what effect?