4. Give the genetic content (2C or C) and the chromosome number of A. cepa during the following phases: Criteria Mitosis Meiosis Fate of Chromosomes Synapsis Crossing-over Occurrence Number of cells formed Stages

4. Give the genetic content (2C or C) and the chromosome number of A. cepa during the following phases: Criteria Mitosis Meiosis Fate of Chromosomes Synapsis Crossing-over Occurrence Number of cells formed Stages

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter11: How Cells Reproduce

Section: Chapter Questions

Problem 6SQ: The spindle attaches to chromosomes at the _______. a. centriole b. contractile ring c. centromere...

See similar textbooks

Related questions

Q: 3. Complete the following table with the number of autosomes and the types of sex chromosomes found…

A: A sex chromosome is the chromosome that determines the sex of an organism. Autosomes are homologous…

Q: ...... the process where portions of homologous chronosomes exchange segments occurs in

A: Homologous chromosomes refer to the pair of chromosomes which is a combination of paternal and…

Q: 5. During meiosis, the number of chromosome a. Doubles from the original cell, then divides in four…

A: 5. There are two divisions in meiosis:- The first division is meiosis 1:- the number of cells is…

Q: 4. Characterize the following human chromosomes as to size and as to position of its centromere.…

A: human chromosome consist of 22 autosomes and 1 sex chromosome.

Q: 5. The somatic cells of Horse have 64 Chromosomes. What is the diploid number for a Horse What is…

A: A somatic cell is any cell of the body except sperm and egg cells.

Q: 6- Explain in no more than 150 words why meiosis is essential for sexual reproduction and the…

A: Cells in the living kingdom can divide primarily by two methods. They are as follows: 1. Mitosis. 2.…

Q: 2. Answer the following questions based on the given karyotype below: 10 11 12 13 14 15 16 17 18 20…

A: Karyotype:- Karyotyping is a genetic process. It helps in pairing as well as ordering the…

Q: 1. Assume that you are married and by chance upon submission for an amniocentesis prenatal checkup…

A: A chromosome is a well-organized DNA molecule located in the cell nucleus. The number of chromosomes…

Q: ________________ most closely resembles events of mitosis except that the cells are ___________.…

A: The correct option is D meiosis II,Haploid . Meiosis is similar to mitosis in many respects. To…

Q: 1. What are the sexes and eye colors of flies with the following genotypes: XRX' XRXR XRY XY L

A: Answering for first question. For rest of question pls repost.

Q: E. Represent the segregation of chromosomes during Meiosis 1 and Meiosis 2 2A. normal segregation in…

A: Chromosome segregation refers to the separation of two sister chromatids or paired homologous…

Q: 3) For each cell below, identify the meiosis phase (meiosis I or II) and stage of meiosis it is in…

A: Cells are the smallest functional and structural unit of all organisms. All cells have a cell…

Q: 22. Mitosis occurs in the somatic cells while meiosis occurs in the - (LT#6) A. blood cells B.…

A: Fertilization is the process by which male and female gametes fuse together and give rise to a…

Q: 2. In the human life cycle, meiosis occurs during the production of 3. In the plant life cycle, the…

A: A diploid organism is an organism that consists of two complete sets of chromosomes (2n) in the…

Q: 3. Fill in the following table contrasting mitosis with meiosis.

A: Cells are the smallest functional and structural unit of all organisms. All cells have a cell…

Q: 2. List 3 important events that occur during meiosis and provide a justification why each should…

A: The indirect process of cell division in which the chromosome of parent cells divide once, but…

Q: 3 offspring in the following order: normal, with disease, normal What would be the probability for…

A: So, according to this condition, Father has the disease and the mother does not even carry the…

Q: Represent the segregation of chromosomes during Meiosis 1 and Meiosis 2 2A. normal segregation in…

A: During Meiosis I, homologous chromosomes segregate; during Meiosis II, sister chromatids segregate.…

Q: 11. A picture of chromosomes paired up from largest to smallest that can give a couple clues about…

A: Answer 11 is Option A is correct; Karyotype. Karyotype is the pictorial representation of…

Q: 2. Compare an autohexaploid and an allohexaploid to each other with respect to the characteristics…

A: Autopolyploids A individual that contains more than two whole copy of its own genome.

Q: 8. List three ways that mitosis differs from meiosis: a. b. C. 9. Define the following terms: a.…

A: There are two types of cell division namely mitosis and meiosis. Mitosis is the process of making…

Q: This diagram shows a parental cell going through meiosis and producing 4 daughter cells. Which cel…

A: Cell division is a phenomenon takes place inside the cell in which parent cell undergo splitting…

Q: 3. The following diagram provides an overview of the information covered thus far. Review the…

Q: 2. Identify the kind of chromosome error in each diagram. Chromosomal Error X X Y TIID ×

A: Chromosomal errors result in various kinds of diseases which are incurable and decrease the life…

Q: Discuss the following terms: - asexual reproduction - nuclear membrane - reproduction - tetrad -…

A: Cell is the fundamental unit of life. Cell biology is the branch of biology that deals with the…

Q: 2. Answer the following questions based on the given karyotype below: 10 13 14 15 16 17 20 22 а.…

A: Chromosomal abnormalities occur when there is a change in number or structure of chromosome from the…

Q: 5. What of the following statements are NOT true regarding meiosis? A. It results in 4 haploid cells…

A: Meiosis is a type of cell division that where a single cell divides twice to produce four cells…

Q: 6. A cell contains 2 pairs of chromosomes. The first pair consists of a chromosome with the T and G…

A: Cell cycle is a series of events that take place when the cell divides. It occurs in following…

Q: 4. Define crossing over. In what phase does it occur? 5. How does the number of chromosomes in a sex…

A: Introduction:- In organisms, sexual reproduction occurs by the union of male and female gametes,…

Q: *5. Describe three main differences between meiosis and mitosis.

A: Mitosis and meiosis are the basics of cell division. They are the reason for the continuity of life.…

Q: Meiosis is necessary because: a. Fertilized ovum will have too much genetic material b. Fertilized…

A: Meiosis is necessary because Fertilized ovum will have too much genetic material.

Q: 1. How will the offspring be affected if one of the gametes or one of the parent carry an impaired…

A: As per the company's guidelines we are supposed to answer a single question at a time only. Please…

Q: 2. The amount of DNA in a Drosophila melanogaster somatic cell equals 8 during G1 of interphase, how…

A: According to the rule, the amount of DNA or chromosomes is the number of chromatids present.

Q: Instructional Technology Subsidy U.. DISMISS MULIIPLt CHUILE Why do males tend to inherit more…

A: Introduction:- A pair of sex chromosomes, XY in men and XX in females, determine biological sex in…

Q: 3. Consider the chromosome pattern AAAXXY in Lychnis. What sex is this? a. Male b. Male with…

A: Chromosomes are thread-like structures found within the nucleus of both animal and plant cells.…

Q: 3 Use the Punnett Square below to identify the phenot- FEMALE SEX CELLS R R RR Rr MALE SEX CELLS Rr…

A: Introduction:- The cross is between two plants, with heterozygous condition (Rr) will produce 3…

Q: 1. A diploid organism has the genotype I1I2V1V2 Y1Y2 on different chromosomes. Diagram only these…

A: In cell biology, mitosis is a part of the cell cycle in which replicated chromosomes are separated…

Q: 5- An individual with a trisomy is an example of: I. an aneuploid individual II. a hypoploid…

A: Failure of chromosomal division leads to deficiency or extra namber of chromosomes in the the total…

Q: 9. Which of the following statements about meiosis is correct? A. Gametes are haploid cells…

A: Meiosis is a type of cell division in which the parent cell is divided into four daughter cells such…

Q: 11 number of chromosomes is present in heart cells of an organism and the sperm of an organism. The…

A: According to the question, we have to find out the number of chromosomes present in the heart cells…

Q: 12. How do cells generate genetic diversity? Basically, through either mutation or genetic…

A: Genetic recombination is a process by which organisms acquire genetic diversity. The exchange of…

Q: 5. Analyze the following statements and identify which statement is correct. a. Mitosis is…

A: Cell division is that the method by which a parent cell divides into 2 or additional cells known as…

Q: 2. What are the genotypes of these flies: white eyed, male white eyed, female red eyed female…

A: Flies have 4 pairs of chromosome in which 3 pairs are the autosome and 1 pair is sex chromosome.…

Q: 13b This must be a stage of Meiosis I because O there is a spindie present. the sister chromatids…

A: Meiosis is a special type of cell division in germ cells, where chromosome number parent cells is…

Q: 9. Match the term with the correct definition. a. process when replicated homologous chromosomes are…

A: In Vivo replication of DNA is a process by which DNA naturally amplifies to form another DNA…

Q: 3. Draw and label the chromosomes of the daughter cells. Telophase (mitosis) Chromosome number…

A: Dividing phase is the second stage of a cell cycle. It is the phase of actual division and is also…

Q: 1. What are the sex chromosomes for: Human: male female Pigeon male female

A: The sex termination system varies from organism to organism. It is studied under the domain of…

Q: 16. The diagram below shows a phase in meiotic cell division. In which phase does this process…

A: INTRODUCTION Meiosis In this division the chromosome number will reduce to half in daughter cell.…

Q: 1. Division of the cell nucleus, results in two daughter nuclei, each have the same number of…

A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…

Q: 3. The diagram below shows an important phase of prophase I of meiosis. Which of the following…

A: The cell is the basic structural and functional unit of the body. It is responsible for various…

Concept explainers

Genetic Evolution

Sexual reproduction produces distinct population variations. Heredity determines the traits and qualities to be passed down to the progeny. Over time, this variation within-species is also affected by the process of human evolution. The study of how genetic variation leads to evolutionary changes is known as genetic evolution. If a trait helps an organism to survive and reproduce, it is more likely to be passed down the generations. It is rare that such traits result in a completely distinct set of traits in descendants than the ancestral population; this can result in the emergence of a new species.

Question

4. Give the genetic content (2C or C) and the chromosome number of A. cepa during
the following phases:
Criteria
Mitosis
Meiosis
Fate of Chromosomes
Synapsis
Crossing-over
Occurrence
Number of cells formed
Stages

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The cell above is a lung cell of a salamander. In which stage of mitosis is it? What are the structures visible in green and blue fluorescence?
The chromosome number ______. a. refers to a particular chromosome in a cell b. is a characteristic feature of a species c. is the number of autosomes in cells of a given type d. is the same in all species
4. Draw a cell in each of the following phases. Be sure to represent the major events of each phase and label structures. Prophase Prometaphase Metaphase Anaphase Telophase Mitosis Internet Lesson. Provided by: Biologycorner.com. License: CC BY-NC: Attribution-Noncommercial Located at: https://www.biologycorner.com//worksheets/mitosis.html
Z File Arial Home 12 8 Type here to search Insert S W X Draw B I U ab 13 #3 3 LLJ Layout E C Review f4 D S X₂ R View O E LL x² 15 Task 6 V AAEEEE A) (1) What types of cells are produced by meiosis and mitosis? C 5 (DJ ACTUAL (c) Why is the curve at A - B steeper than the THEORETICAL line? de in (ii) Explain the significance of the difference in the number of chromosomes. (i) What are the possible uses of the cells produced from mitosis and meiosis? f6 D T G The Cell Assignmen: 22.23 - Saved 6 B 17 Y H W & 7 18 hp 7 N U 19 0 8 4 u M 10 9 Heading 1 15 K ä (A.C.2.3) F11 Heading 2 112 Mahammac Zawia Normal 9 C 7°C Mostly cloudy ^940) scroll diam 19 pause brick Share 12:00 AM 11/24/2022 insert backspace I Ę₂
. For each of the terms in the left column, choose thebest matching phrase in the rigf. satellite DNA 6. small basic proteins that bind toDNA and form the core of thenucleosomeg. chromatin 7. complex of DNA and proteinswhere spindle fibers attach to achromosomeh. cohesin 8. beadlike structure consisting ofDNA wound around histoneproteinsi. histones 9. protein complex that protectstelomeres from degradation andend-to-end fusionsj. shelterin 10. regions of a chromosome thatare distinguished by stainingdifferencesht column.a. telomere 1. protein complex that keepssister chromatids togetheruntil anaphaseb. G bands 2. origin of replication in yeastc. kinetochore 3. repetitive DNA found near thecentromere in higher eukaryotesd. nucleosome 4. specialized structure at the endof a linear chromosomee. ARS 5. complexes of DNA, protein, andRNA in the eukaryotic nucleus
Loune x Untitle xR A MONE X HO No X Mitoe x x dochub.com/zmelvin002//YpbBonNVrx04xQ2RMX93/7/28maryon-melvin mitosisws pdf D Zama x Goes & BI O Zamaryon tMein UNBLOCKED 66-u FORTNITE FAILS & O dioworthiv iof7 (7 WeLove Pepp foe townioad Mus Shoute won Mefvin - Mitosis-ws.pdf Upgrade to Pro 5CA /.0. av. a Sign- 12 Helvetica - TI 2 1 BI 1in -- Number the following sbx dlagrams of the stages of mitosis in animal cels in the proper order. Label each stage with the proper pame. anaphaseo prophase prometaphase
A. Describe the location of the following: Describe the location 1Chromosome 2.Deoxynibonucieic Acid (ONA) 3Gene B. Label the different parts of the cell. 2. waten by OONCIOHN M HERRER C jute juno puede" Umido, Junto aanza con el EduKalidad
FORTNITE FA Lobes Bhe pcture Use the word bank label A. B&CThe words mayy be used more than onG : Chromosome : Sister Chromatids : Centromere : Chromatin
Roman 16px : 1.0pt : BIUS A A X2 x E tion of chromosomes did not occur berore cytoknESIS, 1/2 the # of chromsomes or 1 of each b. If the situation in part a occurred, would the new cells be viable? Explain. no, it wouldnt have the DNA OP 10. The S phase stands for synthesis, which means to make or build something more complex out of simpler parts. Scientists know that during the S phase DNA is being made in the nucleus of the cell. Why do you think the cell needs to make more DNA at this time in the cell cycle? 11. Refer to Model 1. The chromosomes that are shaped like "X" (made of two sister chromatids) have double the amount of DNA than the chromosomes that are shaped like "I." During what phase of the cell cycle do you think the chromosomes are replicated (copied)? POGIL Activities for High School Biology 2. hp
Structure P Cell S State the chromosomal number in parent cell and the daughter cells formed. Parent cell: Daughter cell 1: Daughter cell 2:
--ina Category 1: Cell Structure and Function rartlu into a Prokaryotic Pizza and a Cut out the s Eukaryotic I Reporting Category 2: Mechanisms of Genetics Instructions: Answer the questions shown below on the following answer sheet. SATGAGGGCGAGCGGCGCCCACGTTTTAGGGTGA 3'TACTCCCGCTCGCCGCGGGTGCAAAATCCCACTS 1. What is the name of |||| molecule? Celle whethe is a large cell's gen thin laye The nucl Eukary Prokar tain nu meanin meani otic ce Prol simp 2. What cellular process is being shown by the arrow? 3. Where in the cell does this process take place? S'AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA³ MRNA 4. RNA should be in a 5' to 3'direction. Based on this 5. What cellular process is being shown by the arrow (MRNA to amino Information which DNA strand will be your template strand to make the acida MRNA? 6. Where in the cell does this process take place? Amino acids exce Use the codon chart to determine the correct amino acids. (you may abbreviate) ger 7. How many MRNA bases ot make up a codon?…
15. A cell is considered to be differentiated when it_. (LS1-4) * replicates by the process of mitosis loses connections to the surrounding cells appears to be different from the surrounding cells produces proteins specific to a particular cell type