3. Identify the IMVIG pattern of the following tubes. For set of tubes that is E. coli positive, identify if the reaction is typical or atypical IMVIC Pattern E. coli positive? Yes If yes, type of reaction: No IMVIÇ Pattern E. coli positive? Yes | If yes, type of reaction: No IMVIG Pattern E. coli positive? Yes If yes, type of reaction: No
Q: Explain how early genetic screening can help a baby.
A: Genetics screening is a procedure in which the whole genetic makeup of an individual is tested. This...
Q: how the theory of evolution affects ours view of origin,developtment and spread of new diseases such...
A: Theory of natural selection stated that the survival of the fittest is the ultimate driving force fo...
Q: Why is leguminous crop rotation used in agriculture?
A: Introduction In this question we will discuss about why leguminous crop rotation is used in agricult...
Q: Explain the relationship between photosynthesis and respiration in the cycling of chemicals and flow...
A: Metabolic activity or process are the process taken place inside an organism in which energy is eith...
Q: What is global warming? |
A: Introduction In this question we will discuss about the global warming in below steps.
Q: Research have stated that there are factors that could affect the efficacy and duration of mosquito ...
A: *Mosquitoes are vectors for mamy diseases like malaria and chikungunya abd Zika virus and yellow fev...
Q: If one bit is mutated on the chromosome 11010001, which of the following chromosomes cannot be gener...
A: * Mutations means change in a DNA sequence by altering the bases. *Mutations arise due to mistakes m...
Q: For fruit flies, N=4 and 2N=8 a. Sketch a dividing fruit fly cell which is in prophase I. b. Sketch ...
A: NOTE: Since you have asked multiple questions So we will solve the first par for you. as per our com...
Q: H* ions generated by reactions in the electron transport chain, as well as H* ions present in the ma...
A: The electron transport chain is a series of reaction in four protein complexes, taht creating an el...
Q: Cross a male rat with heterozygous brown fur with female rat with white fur. Note that brown is domi...
A: Let the trait under discussion be labelled as R/r Hence, Brown:- RR or Rr White: - rr When brown rat...
Q: is the collective term for actin and myosin. sarcomere O myofibrils O muscle hiber O skeletal muscle
A: The basic contractile unit of muscle fibre is the sarcomere. Actin and myosin are the active compone...
Q: MLS supervisor is writing an Standard Operating Procedure (SOP) for running a PC test for Hepatitis ...
A: 1. Ongoing quantitative PCR for HBV DNA DNA was extricated from 200 μL of serum utilizing the QIAamp...
Q: Distinguish between polyploidy and aneuploidy
A: A chromosome is a tiny thread-like structure found in the nucleus of eukaryotic cells (animal and pl...
Q: A breeder performed a testcross to find out if his male dog was a purebred black. He got one brown p...
A: Introduction :- An experimental hybrid between an individual organism with a dominant phenotype but ...
Q: Select all the statements that are true regarding the drug treatments available for infectious disea...
A: *Infectious diseases are caused by organisms like bacteria and viruses and fungi and parasites. *Ma...
Q: Describe the various post-translational modifications of HIF- 1alpha and how it affects the regulati...
A: Describe the various post-translational modifications of HIF- 1alpha and how it affects the regulati...
Q: What is the phenotype and genotype of offspring in the following conditions? (use the Punnett square...
A: ABO blood group system consists of four types of blood groups - AB, O, A and B. ABO blood group is a...
Q: ing the following DNA sequence determine the amino acid sequence: AGAGGTCCGCGTTTAGACAT5' et Val Ser ...
A: Complementary strand of RNA is formed by complementary base pairing that occurs between adenine and ...
Q: Please answer the questions and write paragraph. 3: What piece of information did the researchers us...
A: Homo erectus is an extinct Pleistocene archaic human species that initially appeared about 2 million...
Q: What is the significance of putting scale bar in photomicrographs?
A: Scale bar:A scale bar is an instrument or software that attaches to a slide or image when it is imp...
Q: Where does photosynthesis take place in prokaryotes such as Cyanobacteria?
A: Photosynthesis is the process by which plants produce oxygen and energy in the form of sugar by comb...
Q: 21. What are two ways by which SARS-CoV-2 disguises itself from detection by its host-cell's immune ...
A: SARS CoV 2 is a RNA virus, members of large family of virus called corona virus. This virus mainly i...
Q: How might understanding population dynamics help us better manage this invasive species and its impa...
A: Population Dynamics is the study of the Population characteristics like size ,density of the populat...
Q: Give the Morphological characteristics of Aedes aegypti adults.
A: Toxorhynchitinae, Anophelinae, and Culicidae are the three subfamilies of the Culicidae family, with...
Q: construct your own mnemonics on the hierarchy of taxonomy. (example: kindly put candy out for good s...
A: Taxonomic hierarchy - it is the process of arranging various organisms into successive levels of the...
Q: Genotype frequency of two alleles have been calculated to be p = .2 and q = .8 Is this population of...
A: C. Not enough information to calculate this.
Q: What is biology
A: Biology deals with living organisms and their various processes. It is a natural science discipline.
Q: In your own words, kindly give the function and allowable limit (if applicable) of each of the follo...
A: All the given ingredients have their own health benefits. These ingredients are essential and have a...
Q: 1- Determine the classification for the following devices (CE and FDA): A- Single use scalpel B- A d...
A: Introduction:- Medical devices are assigned to one of three regulatory classes based on the level of...
Q: Give meanings for the following combining forms: 1. adenoid/o 6. nas/o 2. alveol/o 7. or/o 3. bronch...
A: Adenoid:- Glandular Alveolar:- Basic unit of functional existence of lungs bronho:- Related to bronc...
Q: Tolerance in the Thymus for CD4+ and CD8+ cells is carried out where? What is meant by positive and ...
A:
Q: Describe safety measures put in place for genetic modification.
A: The Food and Drug Administration (FDA), Environmental Protection Agency (EPA), and Department of Agr...
Q: Can someone explain this? When you cross female flies with white eyes to male flies with red eyes, y...
A: Cross occurs between white eyes females XwXw x red eyes males XWY. Red is a dominant character over ...
Q: There are two types of alleles: Type B1 and Type B2 (In total there are 10) Type B1 has 6 Type B2 ha...
A: Introduction : Here, B1 allele = p = homogygous dominant allele B2 allele = q = homogy...
Q: A population ecologist might study the effect of an introduced predator on the _________ of particul...
A: Introduction: A predator is an animal that kills and eats other animals. Examples of predators are l...
Q: (a)Describe the characteristic and features of a nerve cell observed under high power objective in m...
A: Nerve cells, also known as a neurons, are the active component of the nervous system. Neurons commun...
Q: What happens to the prey species when the predator species population increases? Why? What happens t...
A: Introduction: • An animal that is hunted and killed by another animal known as predator for food is ...
Q: Recall p + q = 1 p2 + 2pq + q2 = 1 p is the frequency of t...
A: If the alleles and genotype frequencies remain same in a population generation after generation then...
Q: When comparing evolutionary similarities between different genes within a gene family, it is usually...
A: A gene is a sequence of DNA that codes for a specific protein. Proteins are the building blocks of o...
Q: Hello, good day. I have a problem answering this question, and I need your help. Hoping for a respon...
A: Flies belong to the order Diptera, which has evolved advanced mechanosensory organs known as haltere...
Q: Match the hormones involved in calcium homeostasis below with the glands or organs that secrete them...
A: Calcium homeostasis refers to the maintenance of a constant concentration of calcium ions in the ext...
Q: The black color of cat fur is incompletely dominant over white and produced a hybrid grey color. Wha...
A: Incomplete dominance It is a form of intermediate inheritance in which one allele for a particular ...
Q: lungs
A: Answer Correct option is C Lungs
Q: 2. Draw a Punnett square of a cross between a homozygous dominant individual and a heterozygous indi...
A: Answer 1: - Parent individuals: - BB (homozygous dominant), Bb(heterozygous dominant) Cross: - ...
Q: What are the developmental stages of Trypanosama? Describe how the stages appear
A: Life cycle of trypanosoma cruzei:- it involves two intermediate hosts : Triatomine insects and human...
Q: Can the amount of available energy on a given trophic level be larger than the available energy on l...
A: Answer
Q: Explain the basic methods of recombinant DNA technology used to isolate,replicate, and analyze DNA ?
A: The recombinant DNA technology deals with modifying gene function by manipulating genes and transfor...
Q: Klinefelter syndrome (XXY) can most be easily diagnosed by_______ . a. pedigree analysis c. karyotyp...
A: Introduction:- Klinefelter syndrome (KS) is a hereditary disease in which a male's genetic code cont...
Q: The efficiency (in terms of increased outputs from fewer inputs) of modern industrial agriculture is...
A: With evergrowing population and constant land and other resources, the production per hectare needs ...
Q: Which part of the nervous system is in charge of the "fight or flight" response? O automatic nervous...
A: Nervous system is defined as the network of neurons and fibres present in the body. It regulates the...
Briefly discuss 2 fluorogenic methods that can be used in detecting coliforms and E.coli. Include the principle and positive results
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
- 8. Pigment or color (e.g.: opaque, translucid, red, yellow, rose, violet, etc..) is also another characteristic that can be used to identify your microorganism in a slant Thus, write down the name of three microorganisms (using scientific notation: Escherichia coli) that present a pigmented pattern of growth in a slant (write down the color of each pigment) and the name of the disease that they may cause. F10 F12 F6 %24 6. R. Home Enter K F G A Shift C Page Up Page Down Alt Ctrl Alt Σ8. Pigment or color (e.g.: opaque, translucid, red, yellow, rose, violet, etc..) is also another characteristic that can be used to identify your microorganism in a slant. Thus, write down the name of three microorganisms (using scientific notation: Escherichia coli) that present a pigmented pattern of growth in a slant (write down the color of each pigment) and the name of the disease that they may cause. 200%- 927 PM 0 日 2/7/2021 21 DELL Insert Delete F11 F12 PrtScr F9 F10 F7 F8 F6 F3 F4 F5 Esc F1 F2 Backspace & # 2$ 8 4 1 2 P Home R T E Enter K Shift V B Page Down Page Up Alt Ctrl Alt THome ノ/ *00 Σ1. If you expose E.coli to UV light at 30 seconds, 1 minute, 3 minutes and 5 minutes, what are your expected results? 2. If you expose. B. cereus to UV light at 30 seconds, 1 minute, 3 minutes and 5 minutes, what are your expected results? 3. If you do not remove the cover of the plate before exposure to UV light at 5 minutes for E.coli and B. cereus, what are your expected results? Help with 1,2 & 3 please
- 1. To test the ability of each diluent to sustain the viability of Escherichia coli during dilution, the cells were incubated at room temperature (20 to 23°C) or 37°C for 0 or 2 h and plated on NA agarin duplicate. The counts obtained are shown in the following table: E. coli counts on dilution time O hour 2 hours Diluents 10-5 10-6 10-7 10-5 10-6 10-7 R1 26 ; 27 3:2 0:0 0:0 0:0 0:0 Distilled Water R2 31 ; 27 1:0 0:0 0:0 0:0 0:0 (DW) R3 27 : 28 4:5 0:0 0:0 0:0 0:0 R1 290 : 295 34 :31 2:1 252 : 239 27 : 26 1;1 DW-0.85% NacI R2 315 ; 309 37 : 34 2;2 250 : 245 26 ; 26 1:0 R3 301 ; 285 36 : 44 1:2 235 ; 267 34 : 21 0:0 R1 385 ; 392 42 : 35 4:5 368 :379 33 ; 32 2:2 DW-3.0% Nacı R2 370 : 388 37 : 40 2:4 305 : 303 35 ; 30 2:5 R3 355 : 365 35 : 28 4:6 370 :350 33: 37 3:1 R1 380 ; 383 30 : 27 2:2 255 : 245 25 : 24 2;2 PBS R2 341 ; 352 27 : 34 1:3 230 : 245 26 : 27 2:2 R3 329 ; 335 33 : 31 3:6 242 : 250 28 : 29 2:1 R1 340 ; 320 32 : 35 1:0 245 : 249 27 : 25 1 1 PBS-0.85% Naci R2 340 ; 345 35 :…t /g = (Log Nt – Log N0) /0.301 I introduce a loopful of Escherichia coli cells (say, 1000) into 10 mL of Nutrient Broth at 8 p.m. the night before your lab. The cells were taken from a culture plate (Nutrient Agar) held at 37°C, and inoculated into broth at the same temperature. They were held at 37°C overnight in a shaking water bath. At what time would the culture reach the Stationary Phase? Recall that doubling time under optimal conditions (these are) is 20 minutes. A growing bacterial culture has 10,000 CFU/mL at noon and 10,000,000 CFU/mL at 6 p.m. What is the generation time under these conditions? What are your assumptions? At midnight you inoculate 10 mL of a culture of Enterococcus with 103 cells/mL into 990 mL of the same medium, held under the same conditions as the original culture. At what time would the culture reach 107 cells/mL? Assume exponential growth over the period. Assume that g=half an hour. Note: We worked a different variant of this problem in…Here is an image of a UV-irradiation (wavelength 254nm) experiment performed on a plate of E. coli after incubation. Which side of the plate do you think has a 'zero-minute' negative control? A or B or neither? Explain with proper reasoning. Egli Eoli ky 9.
- 1. (2.5 pts) A pure bacterial culture of unknown concentration was diluted to determine the concentration of viable bacteria in the original culture. Serial dilutions were performed as diagrammed below. Each dilution tube contained 400 ul of diluent and 100 ul was transferred into each tube. TSA plates were inoculated with 100 µul from the last three dilution tubes. a. What is the dilution between each tube shown in the diagram below? Express your answer as a ratio. b. What is the total dilution of tube number 5? Express your answer as a ratio. c. What is the concentration of viable bacteria in the original culture? Express your answer using scientific notation and the units CFU/ml. d. What is the concentration of viable bacteria in tube number 2? Express your answer using the units CFU/ml. e. If you inoculated a TSA plate with 250 µl from tube number 5, how many colonies would you expect to see after the plate was incubated? 1 2 3 5 423 80 13 Number of coloniesnt ● ● S ● Paragraph F 2. To determine if the type of agar affects bacterial growth, a scientist cultures on fou different types of agar. Five petri dishes are set up to collect results: One with nutrient agar and E. coli One with mannitol-salt agar and E. coli One with MacConkey agar and E. coli One with LB agar and E. coli Styles One with nutrient agar but NO E. coli EdI. Match the bacterium being described in column X with its best classification found in column Y. Choose the best answer. Column X1. Staphylococcus aureus can be grown on mannitol salt agar that contains 7.5% NaCl. The bacterium is________. 2. Lactobacillus acidophilus grows best at pH 4.5. It is considered a(n) ________. Column Y A. acidophile B. alkalophile C. barophile 3. A bacterium that thrives in the Great Salt Lake but not in fresh water is probably a ________.4. Bacteria isolated from the bottom of the ocean need high atmospheric pressures to survive. They are________.5. A bacterium that thrives in a soda lake where the average pH is 10.5 can be classified as a(n) ________. D. halotolerant E. halophile
- 1. The colonies on a negative MSA plate would appear _____________. 2. "E. Coli and S. epidermidis were chosen to represent Gram-negative and Gram-positive bacteria, respectively. For a given antibiotic, is there a difference in susceptibility between the Gram-positive and Gram-negative bacteria?" "No, they are usually similar" "yes, drugs that target the cell membrane are more effective on gram negatives" "yes, drugs that target the cell wall are more effective on gram negatives" "yes, drugs that target the cell wall are more effective on gram positives" how can I tell the difference1:07 < Вack Untitled 6 Brownian movement of bacteria: O a. Can be observed by the of soft agar technique O b. Can be observed by staining of Staphylococcus aureus Oc. Is common in Escherichia coli or Proteus vulgaris O d. Is common in Staphylococcus aureus O e. Can be observed at the edge of a microscope CLEAR MY CHOICEHere is an image of a UV-irradiation (wavelength 254nm) experiment performed on a plate of E. coli after incubation. Which side of the plate do you think has a 'zero-minute' negative control? A or B or neither? Explain with proper reasoning. ICA Exoli Eoli ky