3. Grade is an unsigned byte stored in the program memory (PM). Letter is a byte stored in the data memory. Letter = "A", "B", "C", "D", or "F" based on the value in Letter. (89 < A; 79 < B < 90; 69 < C < 80; 59 < D < 60; F < 60)

3. Grade is an unsigned byte stored in the program memory (PM). Letter is a byte stored in the data memory. Letter = "A", "B", "C", "D", or "F" based on the value in Letter. (89 < A; 79 < B < 90; 69 < C < 80; 59 < D < 60; F < 60)

Name: 3. Grade is an unsigned byte stored in the program memory (PM). Lette
Uploaded: 2024-03-20T06:51:23.000Z
Channel: Bartleby
Description: 3. Grade is an unsigned byte stored in the program memory (PM). Letter is a byte stored in the datamemory. Letter = "A", "B", "C", "D", or "F" based on the value in Letter.(89 < A; 79 < B < 90; 69 < C < 80; 59

C++ for Engineers and Scientists

4th Edition

ISBN:9781133187844

Author:Bronson, Gary J.

Publisher:Bronson, Gary J.

Chapter9: Completing The Basics

Section: Chapter Questions

Problem 7PP

See similar textbooks

Similar questions

(Data processing) Write a C++ program that allows the user to enter the following information from the keyboard for each student in a class (up to 20 students): Name Exam 1 Grade Exam 2 Grade Homework Grade Final Exam Grade For each student, your program should first calculate a final grade, using this formula: FinalGrade=0.20Exam1+0.20Exam2+0.35Homework+0.25FinalExam Then assign a letter grade on the basis of 90100=A,8089=B,7079=C,6069=D, and less than 60=F . All the information, including the final grade and the letter grade, should then be displayed and written to a file.
Language: C Write a program which does the following: a) reads a double from the keyboard, b) reads a float from the keyboard, c) reads an integer from the keyboard, d) stores the product of these three values into the variable result, No information should be lost. e) prints the value of result, f) uses a pointer r-ptr to add 5 to result, g) prints the new values twice, once by using result, once by using r-ptr.
def main(): x = 1 y = 2 swap(x, y) print(x, y) def swap(s1, s2): temp = s1 s1 = s2 s2= temp main() Modify the code so that it actually swaps the values of x and y, without using the temp variable in the swap function.
2. Test Scores File: test_scores.py Write pseudocode for the main() part of a program that asks the user to enter 4 test scores between 0 and 100, then displays a JCU grade for each score and also the average test score. When you have written the pseudocode for main, implement your solution in Python code and test it with a range of meaningful data. Remember that we've done the JCU grades question before, so copy your function from that practical code file. Sample Output Score: 3 Score: 50.5 Score: 66 Score: 100 Score 3.0, which is N Score 50.5, which is P Score 66.0, which is C Score 100.0, which is HD The average score was 54.875 Enhancements When you have that working... We asked for 4 scores. Have a look at your code... did you use 4 as a numeric literal or a constant?Change 4 to 3... Did you have to change the program in more than one place?If so, then you've missed one of the things we've taught...As a strong guideline: if you need to use the same literal more than once, you…
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
Questions: Computer-Assisted Instruction) The use of computers in education is referred to as computer- assisted instruction (CAI). Write a program that will help an elementary school student learn multiplication. Use the rand function to produce two positive one-digit integers. The program should then prompt the user with a question, such as How much is 6 times 7? The student then inputs the answer. Next, the program checks the student’s answer. If it’s correct, display the message "Very good!" and ask another multiplication question. If the answer is wrong, display the message "No. Please try again." and let the student try the same question repeatedly until the student finally gets it right. A separate function should be used to generate each new question. This function should be called once when the application begins execution and each time the user answers the question correctly. PLEASE IN C++ LANGUAGE
In C language, write a program to input two integers x,y and add both the integers using pointers and display the result in the output. The assignment will be rejected if the numbers are added without the use of pointers.
In C programming language: Write a function that takes 3 int arguments and returns the largest of the 3.
Q- Write a program which defines three integer variables, var1, var2 and var3, & initializing them to the values 100, 200 & 300, it then prints out their addresses. Subject: C++
Q5: In C programming, "Char" and "int" data types are used. They represent certain number of bits. Please fill in the blanks for following data types assuming that that the code is running on 32 bit machine. Data type Total number of bits/bytes int char
Customized step counter Learning Objectives In this lab, you will Create a function to match the specifications Use floating-point value division Instructions A pedometer treats walking 2,000 steps as walking 1 mile. It assumes that one step is a bit over 18 inches (1 mile = 36630 inches, so the pedometers assume that one step should be 18.315 inches). Let's customize this calculation to account for the size of our stride. Write a program whose input is the number of steps and the length of the step in inches, and whose output is the miles walked. Output each floating-point value with two digits after the decimal point, which can be achieved as follows: print(f'{your_value:.2f}') Ex: If the input is: 5345 18.315 the output is: You walked 5345 steps which are about 2.67 miles. Your program must define and call the following function. The function should return the number of miles walked.def steps_to_miles(user_steps, step_length) # Define your function here if __name__…
C++ A company hired 10 temporary workers who are paid hourly and you are given a data file that contains the last name of the employees, the number of hours each employee worked in a week, and the hourly pay rate of each employee. You are asked to write a program that computes each employee's weekly pay and the average salary of all the workers. The program then outputs the weekly pay of each employee, the average weekly pay, and the names of all the employees whose pay is greater than or equal to the average pay. If the number of hours worked in a week is more than 40 hours, then the pay rate for the hours over 40 is 1.5 times the regular hourly rate. Use two parallel arrays: a one-dimensional array to store the names of all the employees, and a two-dimensional array of 10 rows and 3 columns to store the number of hours an employee worked in a week, the hourly pay rate, and the weekly pay. Your program must contain at least the following functions—a function to read the data from the…