3. Grade is an unsigned byte stored in the program memory (PM). Letter is a byte stored in the data memory. Letter = "A", "B", "C", "D", or "F" based on the value in Letter. (89 < A; 79 < B < 90; 69 < C < 80; 59 < D < 60; F < 60)
Q: What are the advantages and disadvantages of utilizing robots in the industrial industry? What will ...
A: utilizing robots in the industrial industry
Q: A compiler that examines every character of the original text if you will.
A: INTRODUCTION: COMPILER: In computer programming, a compiler is a program that converts the "code" th...
Q: allow you to build two functions for multiplication as well as modulus. The two numbers must be pass...
A: Code: #include <iostream> using namespace std; int mul(int num1, int num2){ return num1*num...
Q: What are the different kinds of data patterns? Provide instances of each.
A: Data Patterns - The data patterns that are of different types are very much important and also usefu...
Q: Given two positive integers, a and b, where a≥b, create a program in python 3 that uses Euclid's Alg...
A: Algorithm: Start Read number1 n1 and number2 n2 Implement a method named gcd() that takes 2 number ...
Q: Assume the register ($s1) contains (0x87654321). Write at most two instructions to move ONLY the sec...
A: Assembly language code for the given question is below:
Q: Computer science It's possible to sum up how device requests are handled in a few words.
A: Introduction: A computer system can be connected to several I/O devices. However, only a few I/O dev...
Q: Would you want to see more money given to system development or to research and development? Purcha...
A: Justification: Yes, more funds would be allocated to system development over buying existing softw...
Q: How many loops are there in C++? Examine the following loops: While and for loops
A: loops are there in C++
Q: Processes in data flow diagrams are often coded. Which of the following statements concerning coding...
A: Dear Student, There is only one process in context diagram and thus is coded 0.0 Also , coding proce...
Q: When a social engineering hacker attempts to obtain knowledge about a user's login id and password, ...
A: Given: When a social engineering hacker attempts to obtain knowledge about a user's login id and pas...
Q: Write short notes on the access pointer and their manipulators. (C++)
A: Answer the above questions are as follows:
Q: Find out 0(f(n)) for the following and sort the following functions in the increasing order of asymp...
A: Order is: 17<logn <4logn<n<5n=5n<nlogn<n4
Q: 1. Write a program using switch statement to display the days of the week. For example if the user e...
A: Below is the solution for above questions in C Language, output of the screenshot is included at the...
Q: An easy example to explain the order in which constructor and destructor is invoked in C++.
A: Constructor is utilized to declare and initialize the object within class whereas destructor is util...
Q: 9n³ – 3n? + 12 is O(n³) O True O False
A: We are going to check whether given recurrence is in O(n3) or not.
Q: Creating a program that computes the rent in five years and the total rent for one year starting fiv...
A: I give the code in C++ along with output and code screenshot
Q: What are the drawbacks to employing global information systems?
A: - We need to know about the drawbacks to employ global information systems.
Q: What is the CPU time if the programme executes 500 instructions at 5 cycles each instruction and the...
A: Intro CPU time: The formula for computing the CPU time is provided below:
Q: Q;1. what is adtput of this logic gati? A F=?
A: Dear Student, There are only two gates involved in it , AND gate and OR gate. In AND gate we multipl...
Q: Give an overview of the numerous devices that are used in the design of security systems.
A: Introduction: Security systems are meant to assist individuals identify unwanted persons entering th...
Q: Explain the conditions that lead to a system becoming stuck in a deadlock.
A: Introduction: The following circumstances cause a system deadlock: - Circular Wait Condition Hold an...
Q: What approach is recommended for mitigating the majority of failures in distributed systems, and why...
A: Distributed computing systems have their own infrastructure and no shared memory. « They communicate...
Q: Give an example of how composition facilitates reusability. Distinguish between the rules IS-A rule ...
A: Analyze the Issue: The issue is fundamental to OOP. It discusses the two fundamental principles of C...
Q: i need code for face detection using CNN user defined and face recognition using svm clasifier from ...
A: CNN - It is a deep learning algorithm that takes an image as an input and assign some features to va...
Q: Explain multithreading and why it is more popular than other operating system operations.
A: Introduction: Threading is a quick and easy technique. Threads are a software strategy to increasing...
Q: 1. Implement a simple HTML and PHP calculator First Number Second Number 0 Operation +O- O* O/ Compu...
A:
Q: Problem 1: The Mysterious Function We have come through an old interesting function whose pseudo-cod...
A: A- If N<250 Then output is same for all N. def MYSTERIOUS_FUNCTION(n): if n>250: ret...
Q: Process Arrival Time CPU Burst Time P1 9. P2 4 4 P3 1 P4 8. 6. For each of the following algorithms,...
A: Formula Waiting time = Turnaround time - Burst time Turnaround time = Exit time - Arrival time
Q: Write the MIPS assembly code that corresponds to the pseudo code below. Assume that the address for ...
A: Below is the code
Q: What's the behavioral, register-transfer, and gate-level of a FLIP-FLOP circuit and include its mode...
A: What's the behavioral, register-transfer, and gate-level of a FLIP-FLOP circuit and include its mode...
Q: en the following in 32-bit single-precision Floating-point number representation (IEEE-754) in norma...
A: Lets see the solution.
Q: Describe enterprise storage systems, file servers, network attached storage, RAID systems, organisat...
A: A storage device is a system or structure that is used to store the data either temporarily or perma...
Q: Q2.1 Assume all necessary header files and namespace have been included. Is there any error in the f...
A: - We have to evaluate the code for correction.
Q: What exactly does a field in a database represent? What is the significance of this?
A: INTRODUCTION: It is a data field that indicates a certain characteristic or function. Each field in ...
Q: at Is SDLC?
A: SDLC stands or means for "Software Development Life Cycle". It is a methodology or process adopte...
Q: In a C programme, how do you declare a pointer?
A: Introduction: The * character is a unary operator. It returns the value saved at a certain address. ...
Q: What are the measurable aims of usability-assisted design?
A: Introduction: Usability goals include things like speed, accuracy, overall success, and customer sat...
Q: After the successful conduct of Mid Term Examinations, the HOD of the Department of Examinations has...
A: The Answer is
Q: How to write C++ program using array 1D size: 4 with output: Press r to generate 4 random numbers be...
A: The solution to the given problem is below.
Q: What are some of the research distinctions between library subscription databases and popular search...
A: Introduction Library Subscription databases Used to search articles about specific topics. Source-...
Q: arts by choosing a value x, as a first estiman cond, more accurate solution x, can be ca thich is th...
A: The code is shown as,
Q: Vhat are the dangers of building a security infrastructure that is available to everyone?
A: Given: What are the risks of creating a security infrastructure that is open to all?
Q: Why is the transport layer installed in the end system?
A: The answer is given in the below step
Q: CODE USING C++ We've already tried comparing 3 numbers to see the largest among all, so let's try a ...
A: The question is to write C++ code for the given problem.
Q: Discuss transaction processing in the context of Distributed Database Architecture and define the re...
A: Intro Distributed Database Definition: A distributed database is basically a database that is not l...
Q: What protocol secures communications between a browser and a web server using SSL or TLS?
A: Introduction: Hypertext Transfer Protocol Secure (HTTPS) Hypertext Transfer Protocol Secure (HTT...
Q: Given the following binary number in 32-bit (single precision) IEEE-754 format, the decimal value cl...
A: Given binary number 0011 1110 0110 1101 0000 0000 0000 0000 In this left most bit represents sign bi...
Q: Create a pseudocode application that invites the user to enter his or her age and then reports wheth...
A: Pseudocode definition: A pseudocode is a series of instructions or procedures expressed in plain En...
Q: Single form could be saved as an executable extension with: O EXE None of the above Frm VRD
A: FRM is file extension is contains structure data of a table of MYSQL data base
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
- (Data processing) Write a C++ program that allows the user to enter the following information from the keyboard for each student in a class (up to 20 students): Name Exam 1 Grade Exam 2 Grade Homework Grade Final Exam Grade For each student, your program should first calculate a final grade, using this formula: FinalGrade=0.20Exam1+0.20Exam2+0.35Homework+0.25FinalExam Then assign a letter grade on the basis of 90100=A,8089=B,7079=C,6069=D, and less than 60=F . All the information, including the final grade and the letter grade, should then be displayed and written to a file.Language: C Write a program which does the following: a) reads a double from the keyboard, b) reads a float from the keyboard, c) reads an integer from the keyboard, d) stores the product of these three values into the variable result, No information should be lost. e) prints the value of result, f) uses a pointer r-ptr to add 5 to result, g) prints the new values twice, once by using result, once by using r-ptr.def main(): x = 1 y = 2 swap(x, y) print(x, y) def swap(s1, s2): temp = s1 s1 = s2 s2= temp main() Modify the code so that it actually swaps the values of x and y, without using the temp variable in the swap function.
- 2. Test Scores File: test_scores.py Write pseudocode for the main() part of a program that asks the user to enter 4 test scores between 0 and 100, then displays a JCU grade for each score and also the average test score. When you have written the pseudocode for main, implement your solution in Python code and test it with a range of meaningful data. Remember that we've done the JCU grades question before, so copy your function from that practical code file. Sample Output Score: 3 Score: 50.5 Score: 66 Score: 100 Score 3.0, which is N Score 50.5, which is P Score 66.0, which is C Score 100.0, which is HD The average score was 54.875 Enhancements When you have that working... We asked for 4 scores. Have a look at your code... did you use 4 as a numeric literal or a constant?Change 4 to 3... Did you have to change the program in more than one place?If so, then you've missed one of the things we've taught...As a strong guideline: if you need to use the same literal more than once, you…C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…Questions: Computer-Assisted Instruction) The use of computers in education is referred to as computer- assisted instruction (CAI). Write a program that will help an elementary school student learn multiplication. Use the rand function to produce two positive one-digit integers. The program should then prompt the user with a question, such as How much is 6 times 7? The student then inputs the answer. Next, the program checks the student’s answer. If it’s correct, display the message "Very good!" and ask another multiplication question. If the answer is wrong, display the message "No. Please try again." and let the student try the same question repeatedly until the student finally gets it right. A separate function should be used to generate each new question. This function should be called once when the application begins execution and each time the user answers the question correctly. PLEASE IN C++ LANGUAGE
- In C language, write a program to input two integers x,y and add both the integers using pointers and display the result in the output. The assignment will be rejected if the numbers are added without the use of pointers.In C programming language: Write a function that takes 3 int arguments and returns the largest of the 3.Q- Write a program which defines three integer variables, var1, var2 and var3, & initializing them to the values 100, 200 & 300, it then prints out their addresses. Subject: C++
- Q5: In C programming, "Char" and "int" data types are used. They represent certain number of bits. Please fill in the blanks for following data types assuming that that the code is running on 32 bit machine. Data type Total number of bits/bytes int charCustomized step counter Learning Objectives In this lab, you will Create a function to match the specifications Use floating-point value division Instructions A pedometer treats walking 2,000 steps as walking 1 mile. It assumes that one step is a bit over 18 inches (1 mile = 36630 inches, so the pedometers assume that one step should be 18.315 inches). Let's customize this calculation to account for the size of our stride. Write a program whose input is the number of steps and the length of the step in inches, and whose output is the miles walked. Output each floating-point value with two digits after the decimal point, which can be achieved as follows: print(f'{your_value:.2f}') Ex: If the input is: 5345 18.315 the output is: You walked 5345 steps which are about 2.67 miles. Your program must define and call the following function. The function should return the number of miles walked.def steps_to_miles(user_steps, step_length) # Define your function here if __name__…C++ A company hired 10 temporary workers who are paid hourly and you are given a data file that contains the last name of the employees, the number of hours each employee worked in a week, and the hourly pay rate of each employee. You are asked to write a program that computes each employee's weekly pay and the average salary of all the workers. The program then outputs the weekly pay of each employee, the average weekly pay, and the names of all the employees whose pay is greater than or equal to the average pay. If the number of hours worked in a week is more than 40 hours, then the pay rate for the hours over 40 is 1.5 times the regular hourly rate. Use two parallel arrays: a one-dimensional array to store the names of all the employees, and a two-dimensional array of 10 rows and 3 columns to store the number of hours an employee worked in a week, the hourly pay rate, and the weekly pay. Your program must contain at least the following functions—a function to read the data from the…