2. Öriginal DNA: TACGTTTCCCCT MRNA: amino acids: Mutated DNA:TACGTTTGC C C C T MRNA: amino acids: Mutation type: 3. Original DNA: T C CGAGCTTTTA MRNA: amino acids: Mutated DNA: TCGAGCTGTTA MRNA: amino acids: Mutation type:

2. Öriginal DNA: TACGTTTCCCCT MRNA: amino acids: Mutated DNA:TACGTTTGC C C C T MRNA: amino acids: Mutation type: 3. Original DNA: T C CGAGCTTTTA MRNA: amino acids: Mutated DNA: TCGAGCTGTTA MRNA: amino acids: Mutation type:

Name: 2. Original DNA: TACGTTTCCCCTMRNA:amino acids:Mutated DNA: TACGTTTGCC
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 2. Original DNA: TACGTTTCCCCTMRNA:amino acids:Mutated DNA: TACGTTTGCCCC TMRNA:amino acids:Mutation type:3. Original DNA: TC C GAGCTTTTAMRNA:amino acids:Mutated DNA: TC GAGCTGTTAMRNA:amino acids:Mutation type:

Anatomy & Physiology

1st Edition

ISBN:9781938168130

Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Publisher:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Chapter3: The Cellular Level Of Organization

Section: Chapter Questions

Problem 17RQ: Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG...

See similar textbooks

Similar questions

3. The sequence below used the sequence in “1” and encountered a point mutation: TAC-CTA-CGT-AGG-GTT-TAC-ACC-ACA-AGC-CGT-TGG- AAT -GTG-CCA-AAG-TTG-CAG-TGA-AGG- TGA-TGC-TAG-TGA-AAG-CTA-GAT-AGG-GCT-TAT-ATG-AGA-TTT-CGC-CCC-CGA-TAC-GAT-TTG- CTG-AAT-AGA-CTC-GAT-GAA-TCG-CGC-GAT-GTT-ACT a. Determine the mRNA produced by transcription: b. Determine the amino acid sequence after translation (USE “-“ TO SEPARATE AMINO ACIDS, NO SPACES): c. What is the type of point mutation that occurred? 4. The sequence below used the sequence in “1” and encountered a type of frameshift mutation: TAC-CTA-CGT-AGG-GTT-TAC-ACC-ACA-AGC-CGT-TGG-AAC-GTG-CCA-AAG-TTG-CAG-TGA-AGG- TGA-TGC-TAG-TGA-AAG-CTA-GAT-AGG-GCT-TAT-ATG-AGA-TTT-CGC-CCC- CGT -ACG-ATT-TGC- TGA-ATA-GAC-TCG-ATG-AAT-CGC-GCG-ATG-TTA-CT a.Determine the mRNA produced by transcription: b.Determine the amino acid sequence after translation (USE “-“ TO SEPARATE AMINO ACIDS, NO SPACES): c.What is the type of point mutation that occurred? a. Silent mutation…
3. The sequence below used the sequence in “1” and encountered a point mutation: TAC-CTA-CGT-AGG-GTT-TAC-ACC-ACA-AGC-CGT-TGG- AAT -GTG-CCA-AAG-TTG-CAG-TGA-AGG- TGA-TGC-TAG-TGA-AAG-CTA-GAT-AGG-GCT-TAT-ATG-AGA-TTT-CGC-CCC-CGA-TAC-GAT-TTG- CTG-AAT-AGA-CTC-GAT-GAA-TCG-CGC-GAT-GTT-ACT a. Determine the mRNA produced by transcription: b. Determine the amino acid sequence after translation (USE “-“ TO SEPARATE AMINO ACIDS, NO SPACES): c. What is the type of point mutation that occurred? A. Nonsense B. Silent C. Missense
1. DNA coding strand: CCC TCA ATC GAG AAA GGT DNA template strand: MRNA: Peptide chain: 2. DNA coding strand: ATG GCC TGG ACT TCA GGT DNA template strand: MRNA: Peptide chain: 3. DNA coding strand: GGG TGA GCT TTC CCG TTA DNA template strand: MRNA: Peptide chain: 4. DNA coding strand: TẠC TAT GCC TTA ACC CAT DNA template strand: MRNA: Peptide chain: 5. DNA coding strand: TÁC ACC GTT ATC GGG CTA DNA template strand: mRNA: Peptide chain:
2. Muscular dystrophy is a genetic disorder that causes progressive muscle weakness as individual muscle cells atrophy (gradually decline) and die. (Transcribe & Translate the Mutant) Dystrophin Gene (Normal) Dystrophin Gene (Mutant) DNA: GCG-AGC-ATA-CCC DNA: GCG-AТА—ССС RNA: CGC-UCG-UAU-GGG RNA: CGC--UAU--GGG AA: ARG SER TYR GLY AA: ARG--TYR--GLY 2A. Were the effects of this mutation, beneficial, harmful, or neutral? Justify your position based on the image to the left? 2B. What type of mutation occurred in the gene sequence that produced muscular dystrophy? Normal biceps Muscular dystrophy
BONUS: Why do RNA viruses such as the COVID coronavirus, influenza virus and HIV have much higher mutation rates than DNA viruses such as Herpes viruses? O DNA polymerases which copy viral RNA have much higher mutation rates than RNA polymerases which copy viral DNA O RNA polymerases which copy viral RNA have much higher mutation rates than DNA polymerases which copy viral DNA RNA viral 60S ribosomes make many ore mutations than DNA viral 40S ribosomes O RNA viral gyrases make more mistakes than DNA viral helicases
3. DNA Template: CTA - GCG - ATA - AAA - TTT - ATT mrNA: tRNA: Amino acid sequence:
6. Use the image to determine what type of mutation is found in each of the DNA strands below and what type of effect that would have on the protein made. OPTIONS: substitution, deletion, translocation, and insertion. DNA: CCC GGG mRNA: CCC Protein: Pro DNA: GAA CTT mRNA: GAA Protein: Glu DNA: TTA AAT mRNA: UUA Protein: Leu CCA GGT CCA Pro GTA CAT GUA Val TAA ATT UAA Stop Type of Mutation Substitution Substitution Substitution What happens when this type of mutation occurs?
2. Muscular dystrophy is a genetic disorder that causes progressive muscle weakness as individual muscle cells atrophy (gradually decline) and die. (Transcribe & Translate the Mutant) Dystrophin Gene (Normal) Dystrophin Gene (Mutant) DNA: GCG-AТА —ССС DNA: GCG-AGC-ATA-CCC RNA: CGC-UCG-UAU-GGG RNA: AA: ARG SER TYR GLY А:
2. Here is the detailed view of the MCS of the PUC19 plasmid: Sma I KpnI SbfI PstI SacI XbaI ECORI BamHI Sall SphI HindIII agt GAATTCGAGCTCGGTACCCGGGGA TCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGcgtaatcatggtcat 400 410 420 430 440 450 460 ...S N S SP VR PDEL TS R CAH LS P T IM T M lacZa translational start Figure 25: MCS of PUC19 A. If the MCS were cut with Kpn I and BamH I, draw the small fragment of DNA that would be cut out. Show both strands. For reference, here are the recognition sequences: 5' G|GAT СС 3' 3' С СТАG|G 5' recognition sequence for BamH I 5' G GTAC|C 3' 3' cl CATG G 5' recognition sequence for Kpn I Figure 26: recognition sequences for BamH I and Kpn I
Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG ATCCGCGC CGAATATA TGCCTCTC
F3 3 E Which process is illustrated in the diagram? D VW/VVVVVVVVX C Replication Transcription RNA processing Translation 5' Gene expression F4 Q Search R F F5 % 5 V T F6 G 6 O Y F7 H & 7 U B N F8 99+ F9 * 8 8 J 1 1 5 3' N ( 9 9 MO F10 Alt K 2 O 6 P L 3 A F12 ? Ctrl
. I 1 I 2 I 3. I 4. I 5. L . Question 1 DNA TEMPLATE: 3 'GCA TTT GAT AAA TAC CTG AGA TGA CTG ATT GGG GGC AAA 5' 5' CGT AAA CTA TIT ATG GAC TCT ACG GAC TAA CCC CCG TTT 3' 1. Synthesize a piece of DNA to complement the template: 2. Using the given DNA template synthesize the MRNA: 3. What is the amino acid sequence of this protein? Good to go O Focus