2. In your own words, describe two different reasons why a eukaryotic cell may need to control gene expression. What mechanisms of control are present in eukaryotic cells that are not used in bacteria.

2. In your own words, describe two different reasons why a eukaryotic cell may need to control gene expression. What mechanisms of control are present in eukaryotic cells that are not used in bacteria.

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter14: Gene Regulation

Section: Chapter Questions

Problem 6TYU

See similar textbooks

Related questions

Q: Which animals are at the top of the food chain?

A: Food chain : It is the chain which interconnects plants and animals through the energy consumption…

Q: Which of the following is a mechanism of persistent viral infections? O a. Toggles between cytolytic…

A: Persistent viral infection are defined as the infection in which the viruses doesn't cleared out…

Q: 2. [1] Which of the following are NOT necessary components of a. Anticodon b. Polymerase c. Ligase…

A: when the process of transcription completed of DNA to RNA in the nucleus of the cell, ribosomes in…

Q: Involuntary muscle consisting of spindly shaped cells without striations is called: cardiac muscle.…

A: Involuntary muscles are those that do not move or contract under a person's conscious control, i.e.,…

Q: Sensory organs are important anatomical features that helped lineages of vertebrates to succeed up…

A: Introduction The sensory nervous system is a component of the nervous system that processes sensory…

Q: 10 13 ATLAS (coudal view) AXIS (left side) 16 CERVICAL (coudal view)

Q: To state: At least three reasons why forests, mainly the tropical rain forests and boreal forests…

A: The difference between species is known as biodiversity (biological diversity). Biodiversity occurs…

Q: In the presence of lactose and the presence of glucose the lac operon is not expressed . Lacl is […

A: In the presence of glucose as well as lactose, inhibitor/repressors gene is bound to the operator…

Q: Identify the basic steps (in right order) in AFLP marker analysis. Explain briefly how this marker…

A: Basic steps in AFLP marker analysis.

Q: Kim works as a dog trainer. She wants to apply the methods of science inquiry to improve her…

A: Introduction Injury is defined as the physical harm that occurs when the human body is exposed to…

Q: Which assumption below is not required for Hardy-Weinberg equilibrium? Random mating O Large…

A: The Hardy-Weinberg equilibrium is a principle stating that the genetic variation in a population…

Q: What is the Effect of Castration on Nervous System of the Mammalian Male

A: Introduction Castration is any surgical, pharmacological, or other procedure that causes an…

Q: The lungs perform other :physiologic functions Play secondary role in heat exchange and fluid…

A: The lungs are a crucial organ of the body. They are quite spongy and are filled with air with the…

Q: A 21 or 22 base long RNA that binds to certain mRNAs, blocking their translation into protein Group…

A: Ribonucleic acid (abbreviated RNA) is a nucleic acid present in all living cells that has structural…

Q: The principal function for intestinal goblet cells is: Select one: t of a. secreting digestive…

A: Introduction :- Goblet cells are found throughout the small and large intestine and are crucial for…

Q: CHANGES IN THE DIGESTIVE SYSTEM: give a 2-3 sentence description of the NORMAL function of the…

A: Digestive system is mainly responsible for digestion and absorption of food. It occurs in the…

Q: In 5 sentences only, What are restriction enzymes (RE)? Describe how a RE can be used to…

A: Researchers continue to find new medications that aid in the treatment of deadly diseases and enable…

Q: Which is the smallest? O A. a human red blood cell O B. an E. coli cell O C. the influenza virus O…

A: The size of microbes is often defined as tiny. As a result, they are invisible to the naked sight.…

Q: Why do you coat the elisa plate with albumin?

A: ELISA It is enzyme linked immunosorbent assay. It is a common and powerful technique used for the…

Q: Spongy bone is found: in the periosteum in the ends of long bones O inside lacunae only in the fetal…

Q: You were given flies, you decided to determine their genetic make up. You counted approximately 360…

A: Frequency of recombination = (Number of recombinant /total number of progeny ) * 100 Homozygous…

Q: A crop of corn has been bred to grow very large ears of corn. What will cause the next generation of…

A: Plants need sufficient water, optimum temperature, sufficient light, and enough nutrients to grow…

Q: The upper limbs are attached to the axial skeleton by the: O rib cage O pelvic girdle O pectoral…

A: All of the bones, cartilage, tendons, and joints in the human body make up the skeletal system. The…

Q: For allograft transplantation: (a) How do doctors avoid hyperacute rejection?

A: Transplant rejection is the point at which the organ beneficiary's immune framework recognises the…

Q: There are 100 students in a class. Ninety-six did well in the course whereas four blew it totally…

A: Given data, Total number of students in the class = 100 Number of students scoring well =…

Q: +1 1 4 6. 7 8 9. Transcriptional stop sequence +1 ТАTA box ATG ТАА AUG UAA Here is a diagram of a…

A: A base pair is two nucleotides that together constitute DNA ladder." A DNA nucleotide is composed of…

Q: Question: How are amino acid precursors obtained from fatty acids? Show the pathway clearly

A: Introduction The breakdown or storage of fats for energy, as well as the production of structural…

Q: Which of the following diseases is caused by a pathogen that is NOT a living organism? O A. Guinea…

A: A pathogen is an infectious agent that causes a disease. In general, there are five main types of…

Q: What are the scientific names of banana and plantain?

A: A particular species most often has a universal name, which is known as its Scientific Name. The…

Q: Your friend is convinced his calico cat is male. He takes the cat to the vet. Sure enough the cat is…

A: Calico cats have tricolour coat. Their colouring is related to the X chromosome that's why they…

Q: Which of the following statements about bone marrow is CORRECT? yellow marrow is responsible for…

A: Bone marrow is the soft spongy tissue which contains blood vascle, found in centre of the bones.…

Q: (RE) recognition sites marked with arrows. A spontaneous mutation (insertion) occurred in DNA sample…

A: Answer ::

Q: You were given 1000 fruit flies to start a new laboratory colony. Before starting to breed your…

A: In genetic studies, the Hardy–Weinberg concept, also referred as the Hardy–Weinberg equilibrium,…

Q: Biology In your own words describe how antisense RNA is used to regulate translation. Include…

A: Rna is a type of genetic material mostly found in prokaryotic animals like bacteria and viruses .

Q: According to Thomas Malthus, at what rate is the population increasing? a naturally b linearly c…

A: Population rate is the average rate of change of population size in a certain geographic area during…

Q: The dentist in your office asks you to be responsible for maintaining OSHA compliance in the office…

A: Introduction The Occupational Safety and Health Administration, or OSHA for short, is in charge of…

Q: Which of the following fusion of molecules establishes the backbone of an amino acid? 1. An alpha…

A: Amino Acids are monomers of long protein chains. Two amino acids are connected by the peptide bonds…

Q: A corpse was discovered in an apartment last November. It was that of a 50-year-old man who died of…

A: ANSWER;- post mortem interval is 7 hours

Q: Which of the following occurs within the submucosa in most regions of the Gl tract: Select one: a.…

A: Introduction The intestinal mucosa is the inner lining of the digestive tract, and it is in intimate…

Q: Jot down the process that you think will influence the fermentation and compare those process…

A: Introduction Fermentation is a metabolic process that uses enzymes to cause chemical changes in…

Q: Lare a kind of stone tool only made by modern humans. These tools are made of small stone fragments…

A: Stone tools: In the broadest definition, a stone tool is any instrument constructed totally or…

Q: 6a. Complete this flowchart to describe an example of how different versions of a gene can result in…

A: Mutations are alterations in the DNA sequence of an organism. Small changes, such as adding or…

Q: "SOLUTIONS TO OUR PRESENT ENVIRONMENTAL CRISES" are______

A: Introduction When changes in a species' or population's habitat threaten its continued existence, an…

Q: The dentist in your office asks you to be responsible for maintaining OSHA compliance in the office…

A: OSHA's fundamental reason is to make certain that personnel paintings in a secure and invigorating…

Q: The macula densa consists Select one: a. closely-packed nuclei in the epithelium of the distal…

A: Macula Densa: Salt sensors in the juxtaglomerular apparatus create paracrine chemical signals that…

Q: A transposable element or sequence of DNA that can move within the genome Group of answer choices…

A: Transposable elements or sequences of DNA that can move within the genome are also called jumping…

Q: 2

A: 1.Blastocoel 2. Blastopore 3. Mesenchymal cells 4. Animal pol

Q: bulk filter-feeding (baleen only) (not to scale) Pleist. 1.8 Pliocene 5.3 Late bulk filter-…

A: Synapomorphies shared by filter feeding whales :-

Q: If a person exercises to achieve bigger muscles, what effort must be exerted and what actually…

A: Introduction: The amount of force a muscle can create in a single effort is known as muscular…

Q: Which of the following mutations from question 2 could be restored to wildtype by adding CAMP as a…

A: Lac operon Lactose operon is a gene expression system found in E Coli. and many related bacteria. It…

Concept explainers

Reproductive system infection

The biological process through which parents produce new children is called reproduction. A reproductive system is a group of internal and external organs that collaborate to allow males and females to reproduce. Many experts believe that the reproductive system is one of the most important systems in the body due to its crucial function in the survival of the species. Among the body's basic systems, the reproductive tract is the one that differs the most between sexes, and it is also the only one that does not operate until puberty.

Question

Please answer asap

2. In your own words, describe two different reasons why a eukaryotic cell may need to
control gene expression. What mechanisms of control are present in eukaryotic cells
that are not used in bacteria.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

1. Describe which enzymes are required for lactose and tryptophan metabolism in bacteria when lactose and tryptophan, respectively, are (a) present and (b) absent. 2. Contrast positive versus negative regulation of gene expression. Describe the role of the repressor in an inducible system and in a repressible system.
3. Explain the three stages of transcription in Eukaryotic cellI. Identify all enzymes used with their corresponding function. Promoter ТАТАAА -30 +1 Transcription start site TEIID ТВР +1 Transcription start site TEIIB TEIID TEIIA ТВР +1 Transcription start site TEIE TEIIE TEIIB TEIID TEIIA TEIIH ТВР +1 Transcription start site RNA Polymerase II
1. Describe which enzymes are required for lactose and tryptophan metabolism inbacteria when lactose and tryptophan, respectively, are (a) present and (b)absent. 2. Contrast positive versus negative regulation of gene expression. Describe therole of the repressor in an inducible system and in a repressible system.
6. Similar to the class notes (Intro to Genetics), a segment of DNA (shown below) contains a promoter segment (the first 9 base pairs), a ribosome binding segment (the next 6 base pairs), and a segment that codes for protein synthesis which is started by the rest of the base pairs. ACTCCATTGAACCATTTCTATGATCCGCTAACG-... TGAGGTAACTTGGTAAAGATACTAGGCGATTGC-... A. When the DNA is induced to be copied to mRNA, the top strand is coding, meaning that the mRNA makes an identical copy of the lower strand (replacing T with U) The mRNA copy starts with the ribosome binding sequence. What is the sequence of the mRNA that will go to the ribosomes? B. What are the first 6 amino acids of the protein that are coded for by the mRNA? C. What would the amino acid sequence be if... i. a transition mutation occurred on the final G in the mRNA? ii. all of the G & C bases in the protein synthesis portion had transition mutations? iii. a point deletion mutation occurred in the ATA sequence (in the lower strand…
4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5..ТТCGAGCTСТСGТCGTCGAGATACGCGATGATATTACTGGTААТАТGGGGATGCАСТАТС..3' 3'...AAGCTCGAGAGCAGCAGCTCTАTGCGСТАСТАТААТGACCATTATAССССТАСGTGATAG..5' * promoter i. Mutant A has a single base pair substitution with the T/A being replaced with C/G base pair at position 35 (position denoted by the * in the sequence above). ii. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above).
1. A strain of E. coli is genetically engineered in which the lacZ and lacY removed and replaced with a gene encoding a fluorescent protein. In addition, scientist produced a partial diploid E. coli strain, i.e. bacteria that have one full copy of the lac operon in their chromosome plus another copy of the lac operon in a plasmid. The modified bacteria have the follow genetic components: genes are One copy of the operon in which the protein product fluoresces green is inserted into the bacteria chromosome One copy of the operon in which the protein product fluoresces red is inserted into a plasmid. Both copies of the lac operon carry one copy of wild-type Promoter (lacP) and Operator (lacO) cis-acting DNA sequences. The modified bacteria have only one copy of the lacI repressor gene in their chromosomes. The lac operon in the plasmid doesn't have the lacI gene. If both fluorescent proteins are expressed, the cells fluoresce yellow and if neither of the fluorescent proteins is…
4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...3' 3' ...AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...5' * promoter
1. Contrast positive versus negative regulation of gene expression. Describe the role of the repressor in an inducible system and in a repressible system.
2) Briefly describe 6 different ways that eukaryotic cells typically regulate Gene Expression
Which of the following statements is/are true about gene regulation in bacteria? Choose all that could apply Multiple answer apply A genes with related functions are often grouped together and are transcribed into a single piece of RNA B small molecules act as sensors and bind DNA to change its 3D shape C enhancers are commonly used to regulate transcription D repressor proteins block transcription by binding to operator sequences E activator proteins bind near promoters and increase the efficiency of transcription
5. Genes A, B, and C encode enzymes A, B, and C, which are part of this biosynthetic pathway: Translation Proteins (enzymes) Biochemical pathway Precursor Intermediate Product products Describe how the coordinated expression of these genes might be achieved in BOTH bacterial and eukaryotic systems.
Four terms and statements related to gene regulation in bacteria are listed below. Match the correct term to each of the four statements: Regulatory molecule that binds to operator region in DNA. 1. repressor Regulatory molecule that must be present at a site in DNA (such as promoter) so that transcription occurs. 2. Constitutive 3. Effector Small molecules that bind to regulatory molecule, such as repressor. 4. Activator Phenotype of I+ oCz*