1CFD CALCIUM-FREE CALMODULIN How long is the protein’s primary sequence? Does this protein have any secondary, tertiary and/or quaternary structures present? Are there any molecular additions to this protein that are not amino ac

1CFD CALCIUM-FREE CALMODULIN How long is the protein’s primary sequence? Does this protein have any secondary, tertiary and/or quaternary structures present? Are there any molecular additions to this protein that are not amino ac

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter9: Cell Communication

Section: Chapter Questions

Problem 11RQ: What property enables the residues of the amino acids serine, threonine, and tyrosine to be...

See similar textbooks

Related questions

Q: Given: Cryo-EM structure of PCoV_GX spike glycoprotein 1. What can you tell me about the identity…

A: Viruses are non-cellular particles that need a host cell to survive. Viruses are not considered…

Q: V-B. Which of the following peptides would be more soluble at the indicated pH? 1. (Gly)20 or…

A: The twenty amino acids are classified into majorly the following classes: Polar Nonpolar Positive…

Q: Both hsp60-like and hsp70 molecular chaperonesshare an affinity for exposed hydrophobic patches on…

A: Molecular chaperones are defined as the proteins that aid or help in the folding or unfolding of…

Q: 18. Chaperones are frequently associated with polypeptides as they are being synthesized from the…

A: Chaperons are proteins that are primarily concerned with protein folding. It prevents the…

Q: 1. Subunit Composition of a Protein A protein has a molecular mass of 400 kDa when measured by gel…

A: Gel electrophoresis is a laboratory method that can be used for sorting protein mixtures by…

Q: 13. Shape and dimension. (a) Tropomyosın, a 70-kDa muscle protein, is a two-stranded a-helical…

A: Secondary structure of protein: Formed due to twisting of the polypeptide chain.The folding is due…

Q: Can you help find the c terminal at ph 9.5?

A: The given hexapeptide is composed of serine, histidine, glutamate, cysteine, arginine, and…

Q: Determining the amino acid sequence in a protein usually in- volves treating the protein with…

A: Treatment of a polypeptide with eleven amino acids with one reagent gives the following fragments :…

Q: 5'-ATGGAATTGGCATGGTTTACCCGTGATGGT-3' 3-ТАССТТААСCGTACCAAATGGGCACTACСА-5' 1. Determine the sequence…

A: Since we answer the first question in case of multiple questions. If you want any specific question…

Q: Met-enkephalin (Tyr–Gly–Gly–Phe–Met) is a painkiller and sedative (Section 21.5). What is a possible…

A: Metenkefalin could be an artificial kind of the naturally occurring, endogenous opioid amide,…

Q: 6. Celiac disease is a disorder of the small intestine characterized by autoimmune response to…

A: Gluten protein is commonly found in many cereals like Wheat, barley, rye etc and is difficult to…

Q: 5. Protein folding is largely influenced by the interaction of the R-groups (side chains) with the…

A: Hi! Since you have posted multiple questions and have not mentioned which to answer, we will answer…

Q: Structure of lactam.. 1) Why this lactam would be evolutionarily selected against? a. Amino acids…

A: β-lactam antibiotics are antibiotics that contain a beta-lactam ring in their chemical structure.…

Q: CH3CO-ETATKAELLAKYEATHK-CONH2 4. A polypeptide comprised of 17 amino acid res- idues with the…

A: Polypeptide: These are chains of amino acids with peptide bonds that connect them. Dehydration of…

Q: The free energy of folding of a protein is -17kJ/mol. What tenoerature (C) do you have to heat the…

A: Protein folding is related to protein stability that is the thermodynamic stability, not the…

Q: Which statements are true? Explain why or why not.1 Each strand in a β sheet is a helix with two…

A: As per our honor code, we are authorized to answer one question at a time, since you have not…

Q: 6a. What is the peptide's net charge at pH 2.0, pH 6.0, pH 7.4, and pH 10.2? (show work) 6b. What is…

A: Amino acids are the fundamental units of proteins. Each amino acid has an amino group (-NH2) and a…

Q: 6. Celiac disease is a disorder of the small intestine characterized by autoimmune response to…

A: Gluten protein is commonly found in many cereals like Wheat, barley, rye etc and is difficult to…

Q: 62. Which of the following cases DOES NOT illustrate protein denaturation? A. Breakdown of the…

A: Antibody: It is also known as Immunoglobulin. It is a protective protein that helps our body to…

Q: B. For each of the following amino acid sequences in the protein, predict the most likely secondary…

A: "Since you have asked multiple questions, we will solve the B question for you. If you want a…

Q: 21. Which protein structure is most consistent for the hydropathy graph of the intrinsic membrane…

A: Hydropathy graph depicts the hydrophobicity and hydrophilicity of a polypeptide chain based on the…

Q: A280/ A260 of 1.3. Estimate the pro 1. A solution of a purified protein yielded 0ontration of the…

A: Standard curves of purified reference proteins are used to determine the concentration of the…

Q: Can you please help find what Gln is at ph 9.5?

A: Amino acids are the building blocks of proteins or peptides. There are twenty standard amino acids…

Q: 15 Which of the following amino acids would most likely be present in the boxed section, assume…

A: A protein is made of a polypeptide chain of amino acids and every amino acid is of different…

Q: 63. Which of the following statements is CORRECT about protein denaturation? A. Complete protein…

A: The correct option is (b), loss of protein conformation causes loss of protein function.…

Q: 64. Cooperativity in the unfolding process during protein denaturation suggests that loss of A.…

A: Cooperativity in the unfolding process during protein denaturation suggests the loss of (C)…

Q: (12) Name the four different types of interactions responsible for creating tertiary structures in…

A: Four different types of interactions responsible for tertiary structure of protein are:- 1)…

Q: Can you please help find the charge of this side chain?

A: Glutamic acid is an α-amino acid that is employed in the production of proteins by practically all…

Q: HN H3Ñ® Where on this amino acid does it attach to a primary sequence of a protein and where is the…

A: Given amino acid, Histidine is a basic amino acid. The structure of Histidine is presented as a…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: 22. Some tRNAs contain inosine, which can base pair with A, C, and U. Why might this be advantageous…

A: The interaction between the molecular surfaces occurs due to various reasons. The reasons…

Q: 1) In MALDI-TOF data, when performing peptide mass mapping search, a) The number of peptides…

A: Protein identification with the help of mass spectrometry (MS) is an major step in proteomic…

Q: 22. Describe the Induced fit of Hemoglobin, Hb (enzyme-like protein) which has quarternary structure…

A: The induced fit model is a model for the interaction of enzymes with substrates. It states that only…

Q: Why is picric acid and tannic acid used in treatment of burns?

A: Picric acids are organic compound, which has several important roles such as antiseptic drug,…

Q: 17. Protein folding results in a large decrease in entropy since a polypeptide is now constrained…

A: The unfolded protein has high entropy when compared to folded protein. The entropy of denatured…

Q: GTTTTCACTGGCGAGCGTCATCTTCCTACT 10. Generate a secondary structure prediction for one identified…

Q: 29. In sickle cell anemia, a hereditary disease, there is substitution of one amino acid by another…

A: Sickle Cell anemia

Q: GT 3 A. Write the structure of the pentapeptide GLDSC. B. What is the complete name of this…

A: Hi, thank you for posting the question on Bartleby. As per the guidelines, we can answer only one…

Q: what are the first 4 amino acids in the polypeptide sequence of SARS-CoV-2 surface glycoprotein

A: The coronavirus disease caused by the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)…

Q: 76) Nuclear localization signal can be a. Simple sequence in which we have a stretch of acidic amino…

A: A nuclear localization signal (NLS) is an amino acid pattern that 'marks' a polypeptide for nuclear…

Q: 5. Heparin, a highly negatively charged glycosaminoglycan, is used clinically as an anticoagulant.…

A: Heparin is an anticoagulant or blood thinner that recent blood clotting. It is known to bind…

Q: 1a) In MALDI-TOF data, when performing peptide mass mapping search, the number of peptides and the…

A: Protein identification with the help of mass spectrometry (MS) is an major step in proteomic…

Q: 17. How would you computationally predict the thermodynamic stability of a long, extended RNA helix?…

A: Thermodynamic stability is the state when the structure is in a conformation that has the lowest…

Q: Hydrogen bonds are usually 2.7-3.3 angstrom long. According to this information, do you think there…

A: There is no direct hydrogen bonding between H840 and the phosphodiester bond that links dG13 and…

Q: 2. Draw the Fisher projection for the following amino acids: a. L-Threonine b. L-Phenylalanine C.…

A: Fischer projection is the two dimensional representation of a three dimensional molecule.

Q: Denaturation is basically the dis arrangement of intramolecular interactions in a tertiary structure…

A: 35. True, Denaturation is a process in which proteins lose their native conformation i.e. normal,…

Q: Referring back to the quaternary level proteins, list and describe the modifications that can be…

A: The structure of protein includes sequence of amino acids in a polypeptide chain. The formation of…

Concept explainers

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.

Question

1CFD

CALCIUM-FREE CALMODULIN

How long is the protein’s primary sequence?
Does this protein have any secondary, tertiary and/or quaternary structures present?
Are there any molecular additions to this protein that are not amino ac

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

Thr-Lys-Pro-Ile-Val-Ala-Pro-Met-Glu-Tyr-Gly-Lys Write the sequence using one-letter abbreviations. sequence: TLPIVAPMGYGK Incorrect Estimate the net charge on the peptide at pH 7. charge at pH 7: +1 Estimate the net charge on the peptide at pH 12. charge at pH 12: 0 Incorrect
Antiparallel B sheet 寧 ; Ala side chains Gly side chains Figure 4-14a Lehninger Principles of Biochemistry, Seventh Edition 2017 W. H. Freeman and Company The structure of spider silk is shown above. Mutating the alanine residues to arginine is expected to disrupt the beta sheet structure. Please provide two reasons why mutating the alanine residues to arginine would be expected to disrupt the beta sheet structure.
Leu-Trp-Phe-Met-Ala-Ile-Val- Draw the structure of the peptide at pH7.4. and Indicate the hydrogen bonds formed in the alpha helix.
On average, how many phosphoanhydride bonds (P;-P; bonds) are directly hydrolyzed in thecourse of synthesizing a 200 amino acid protein? Assume that you begin with the mature mRNA,ribosomal subunits, tRNAs, free amino acids, and all necessary factors.
Please help! Sketch a titration curve of the peptide Ala-Tyr-Gln-Met-Asp-His from pH=0 to 14 up to 5 equivalnets of KOH (Please type answer)
Both hsp60-like and hsp70 molecular chaperonesshare an affinity for exposed hydrophobic patches on pro-teins, using them as indicators of incomplete folding. Whydo you suppose hydrophobic patches serve as critical sig-nals for the folding status of a protein?
3 of 3 A protein was completely digested with trypsin and an internal peptide (i.e. not derived from the N- or C-terminals) was purified. Determine its sequence from the following information: a) amino acid analysis yields one mole of D, T, P, L, Y, F, K, and R per mole of peptide; b) treatment of the intact peptide with FDNB, followed by acid hydrolysis, gives DNP-L and &-DNP-K; c) treatment of the intact peptide with chymotrypsin yields a tripeptide containing K, T, and D; a tetrapeptide containing P, L, F, and R, and free tyrosine; d) the tripeptide, in part c, yields DNP-T and ɛ-DNP-K after reaction with FDNB and acid hydrolysis. Note: trypsin will not cleave on the carboxyl side of arginine or lysine if the next amino acid (donating the amino group) is proline. Put your answer here:
The peptlde bradykinln is a nonapeptlde. Give the name of the peptide (shown below) by namlng the amlno aclds from the N-terminal to the C- terminal. Use the long name, the 3-letter abbreviation and the 1-letter abbreviation. What is the pl of this peptide? Name Compositon Fxnction LOcalizatio Bradykinl Inflammatio Different n and H N vasodilation Cells HNH n Animal H. HNH H NH он HN N HO
A At pH 5, what is the net charge of the peptide Val-His-Gln-Cys-Ser-Lys? 0 -1 0 0+1 Ⓒ +2 Q Search "de 96 5 ******* ******* 131183 J- C 8 a hp
With, Asp-Cys-Lys-Arg What are the pH buffering regions (pH range)? What is the charge at ph 4? Please explain how you find this out. Thanks!
0ミレーNレ NH geometry on both cand N. Torigonal plannes CH - C-N o=), HN CH2 CH-C-OH (a- carbon) CH2 HooC Aspaxagine - Toline - Valine - Arginine - phenylalcmine - Glutamic ocid. 1.Give the name and three letter code for each amino acid in the peptide. e 2. At pH 7, approximately what charge would be on your peptide? Explain your answer. 3. Can your peptide form intra/interchain disulfide bonds? Explain why/why not. e 4. Will your peptide absorb UV and is it fluorescent? Explain why/why not. e 5. What is the probability that your peptide contains a cis peptide bond? Explain your answer.
The peptide below -NH-CH- H3N-CH- CH3 NH-CH- -NH-CH- -O- -NH-ÇH- CH2 CH2 CH2 HN-ç=NH, NH2 CH2 CH2 CH Ho-CH, C-OH H,C CH3 needs to be separated from a second peptide with a primary sequence ADES. At what pH range would it be possible to separate the peptides? O 0- 2.0 O 2.5 - 3.5 O 4.0 - 9.0 O 13.0 -14.0 о 10.0-12.0