12. What is the major organic product obtained from the following reaction? OCH 3 Br2 CH3CO₂H Br 1 2 OCH3 3 OCH 3 4 OCH3 Br Br CH3 CH3 CH₂Br CH3 CH3

Q: R 20 O- protein N CH3 H₂N asparagine side chain HO OH OH activated sugar Draw the product of the…

A: An O-glycosidic bond is a covalent bond formed between a carbohydrate's anomeric carbon and the…

Q: 3. Acetylcholinesterase is a serine hydrolase enzyme im- portant in nerve signal transmission,…

A: Approach to solving the question: Enzyme reactions. Detailed explanation:1. here's an arrow-pushing…

Q: Camels survive in the desert because they derive water from the large deposit of triglycerides…

A: We are considering the breakdown of the triglyceride, tripalmitoylglycerol. Tripalmitoylglycerol is…

Q: (a) In the space below draw a free energy landscape diagram for the conversion of substrate (S) into…

A: Transition state theory states that as a substrate is converted into a product, a high energy state…

Q: In a tabular form list two differences between heat shock and electroporation as  methods of…

A: Transformation is the process by which a cell takes in naked DNA from its environment. Heak shock…

Q: Sketch out the binding site of Hemoglobin with oxygen bound  . ( You can abstract the Heme ring out…

A: Hemoglobin is a metalloprotein that contains iron. Hemoglobin is present in the red blood corpuscles…

Q: what is The standard free energy change for the combined system that you wrote in the previous…

A: The standard free energy change (∆G°) of a chemical reaction is the free energy change at the…

Q: In the salvage of purines, hypoxanthine-guanine phosphoribosyltransferase (HGPRT) is responsible for…

A: Purines are heterocyclic rings made up of a five-membered ring fused to a six-membered ring.…

Q: why do so many pharmaceutical drugs contain nitrogen? How would an NH2 group benefit this dimer…

A: The objective of the question is to find the reason why so many pharmaceutical drugs contain…

Q: 12. What value do O-linked saccharides serve for membrane surface proteins? Which amino acid…

A: O-linked saccharides, also known as O-linked glycans, are carbohydrates that are attached to…

Q: B-oxidation deals with only saturated fatty acids, but many fatty acids in natural lipids are…

A: Beta oxidation is a metabolic process in which the two carbon atoms are sequentially removed from…

Q: Fill in the RNA quantification table below: Sample A260 A280 A260 A280 Concentration (ng/μl)…

A: The conversion factor depends on the type of RNA being quantified.Conversion factors for different…

Q: Certain bacteria can respire in anoxic environments using arsenic (V) as electron acceptor. The…

A: “Since you have posted a question with multiple sub-parts, we will provide the solution only to the…

Q: You will have to dilute your inital Lysozyme stock in order to pipet volumes larger than 10 uL for…

A: Step 1:For the Bradford assay, the typical concentration range of protein you want to target is…

Q: Identify the product of the given reaction. IV I II III heat ? = III IV

A: Option (d) III is correct See solution in image  Explanation:

Q: 111: 900 Page 3 (b) Construct an energy-level diagram of 2-pentene showing the relative energy…

A: Already done Explanation:Step 1: Step 2: Step 3: Step 4:

Q: The conversion of pyruvate into acetyl CoA consists of three steps. Identify these three steps and…

A: The pyruvate dehydrogenase complex (PDHC) is an enzyme complex composed of 3 enzymes.Pyruvate…

Q: The kinetic data in the following table were obtained for the reaction of carbon dioxide and water…

A: The substrate affinity of CO2 for carbonic anhydrase or Km is found to be 10 mM.Explanation:Step 1:…

Q: 1. Opine dehydrogenases (ODH) have evolved in invertebrate marine organisms with wide-ranging…

A: To determine the L/D configuration of amino acids, place the alpha carbon () in the center, the…

Q: Carbamazepine is a lipid -soluble antiepileptic drug that has a larger volume of distribution in…

A: The objective of the question is to understand the effect of obesity on the elimination half-life of…

Q: p53 is an activator of a miRNA called miR-145. miR-145 targets c-myc, a gene that promotes cellular…

A: Increased proliferation and survival.Explanation:Increased proliferation and survival would be the…

Q: None

A: The statement in question relates to the process of decarboxylation in the tricarboxylic acid (TCA)…

Q: With the ninhydrin method, it was determined that an acyclic decapeptide consists of the following…

A: Elastase cleaves the peptide bonds formed by small hydrophobic amino acids, towards the C-terminal…

Q: Biochemistry...Represent the reactions when Phosphatidylethanolamine was treated with; (I)…

A: Phosphatidylethanolamine (PE) is a type of phospholipid found in cell membranes. It consists of a…

Q: Studying mis-splicing events on a cell-wide basis (i.e., all mis-splicing events in a cell type) can…

A: Studying mis-splicing events on a cell-wide basis (i.e., all mis-splicing events in a cell type) can…

Q: 2. What is the major organic product obtained from the following reaction? CH3 Brz FeBr3 CH₂Br CH3…

A: Step 1:

Q: Ringlemann scale is used to analyze O a. Carbon monoxide Ob. Nitrogen dioxide O c. hydrocarbons O d.…

A: The objective of the question is to identify the substance that the Ringlemann scale is used to…

Q: 16. A quantitative study of the interaction of a protein with its ligand yielded the following…

A: I cannot plot the graph as that would be doing your homework.Determine KD:From the graph, read the…

Q: Consider the reaction below to answer the following question(s). A B C NO₂ FeBrz + B12 D Fill in the…

A:

Q: What is the concentration in ppm of Sulphur in a water supply if there are 0.002mL of Sulphur in…

A: Step 1:We need to use the conversion 1ppm= 0.001mL/LBased on the given,Since we have 0.002mL/L…

Q: Which of the following has the compounds shown in the correct order of decreasing acidity (i.e.,…

A: Step 1: • Let's understand step by step: 1) Acidic Behavior: A compound is considered acidic if it…

Q: Biological Macromolecules Identifying molecules that could be in a cell membrane te for advanced…

A: Cell membranes are mostly composed of phospholipids. An important characteristic of phospholipids is…

Q: 9. A) Please write down the names of the following protein folds. A B C B) Which one(s) is made of…

A: C) Haemoglobin the motif is coiled structure which facilitates binding of four polypeptide chains,…

Q: What percentage of max is obtained when the substrate is present at 80% of the Km? Use two digits in…

A: is the maximum velocity attained by an enzyme during a reaction. is the substrate concentration at…

Q: using sample prep aka the protocol use it to fill in the tables

A: Explanation: Lysozyme (mL): The amount of lysozyme diluted and added to each conical tube. The…

Q: What is the final reaction in the final round of fatty acid synthase? Acetyl-CoA ACP Transacylase…

A: The question is asking about the final reaction in the process of fatty acid synthesis. Fatty acid…

Q: Derive an Equation that explains the realtionship between kE and kN with respect to the equilibrium…

A: Equation: This reaction is governed by the equilibrium constant ​, where:       - (1)Assuming that…

Q: 1. What is the isoelectric point of tyrosine? Draw out the different structures of tyrosine at each…

A: **Since you have posted multiple questions, we will provide the solution only to the first question…

Q: The following diagram show what is required for an active promoter of a gene of interest, where:A1 =…

A: Based on the given diagram, here are the predictions:Chromatin conformation: EuchromatinMethylation…

Q: A coal fire plant uses 1 kg of coal to generate 1000 kWh of electricity and emits 50 kg of CO2 and 5…

A: The objective of the question is to understand the relationship between the functional unit (FU) and…

Q: 2. The precise biochemical mechanisms underlying the rapid shutdown of glycolysis in skeletal muscle…

A: (a) Approach to solving the question: The main process by which glucose is broken down to produce…

Q: Reaction rate 0.35 0.30 0.25 0.20 0.15- 0.10 0.05 0.00 0 1000 2000 Enzyme total is 5mM 3000 4000 1.…

A: MM graph is constructed by taking substrate and reaction velocity on X and Y axes respectively. The…

Q: 7. What is the driving force that promotes secondary structure formation of alpha helices and beta…

A: Two types of secondary structures are abundant in protein: alpha helix and beta sheets.The alpha…

Q: 8) Consider the tetrasaccharide stachyose drawn below. Stachyose is found in white jasmine,…

A: Stachyose is a tetrasaccharide consisting of two D-galactose units, one D-glucose unit, and one…

Q: Draw the major organic product of the following reaction. conc. KMnO4, heat

A: Answer is given below Explanation:

Q: Please help me fill in all the information

A: 1. **Conversion of Pyruvate to Acetyl-CoA**:   - **Pyruvate Dehydrogenase Complex**: This complex of…

Q: MATCH a structure or term from the following list with each description below. Place the letter of…

A: 1. The reactive electrophile in Friedel-Crafts acylation reactions (R3C⁺): In Friedel-Crafts…

Q: Draw the structure of the isoprenoid biogenic precursor of the terpenes and show the steps in the…

A: Terpenes are unsaturated hydrocarbons produced by conifers (plants). Their general chemical formula…

Q: 3'- AATAAAAAAGGTCCCAAAAAATTAGGGGAGACGGTACATAAA GAGTAGAGTCATAAATTTTAGAGATGCGTA - 5' Table 22.4 mRNA…

A: The process of protein synthesis is also known as translation. The process of translation is…

Q: -22 2. (10 pts) Overlapping part of wave function of C-O bond (from to + in x-axis) is expressed by:…

A: The detailed ans has been attached. Explanation: