1.Promoters usually contain an AT-rich sequence. How is this beneficial to transcription?
Q: Why do we need to add “COLD” alcohol? What is the effect of the temperature of the alcohol in the…
A: DNA is extracted from various sources to study the sequence of the DNAs from various sources and to…
Q: Polysaccharide Chondroitin Heparin Hyaluronate Dermatan Sulfate Keratan Sulfate Mucin Unique Feature…
A: A polysaccharide is a large molecule composed of numerous smaller monosaccharides. Monosaccharides,…
Q: On average, 180 liters of plasma are filtered each day. A If humans had to expend one molecule of…
A: The cell uses and stores ATP (Adenosine Triphosphate) as an energy source. Adenosine, ribose sugar,…
Q: Which of the following is NOT a major source of protein? A. fish B. Milk C. Egg D. Rice
A: Introduction: Proteins are organic substances and polymers of amino acids. The elements present in…
Q: Trypsin cleaves a polypeptide backbone at the C-terminal side of Arg or Lys residues, whereas…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Which of the following is NOT one of the products of the pentose phosphate shunt?
A: The pentose phosphate pathway is the one important metabolic pathways which is take place in most of…
Q: A) What is the difference between a nucleoside and a nucleotide? B) Give any two differences between…
A: DNA as well as RNA are two crucial building blocks of life. The human cells also comprises of RNA…
Q: Please describe the protein purification process with the aim of purifying a protein which locates…
A: We will answer the first question since the exact one was not specified. Please submit a new…
Q: Name and describe the four weak chemical interaction that occurs in biomolecules.
A: Biomolecules are the essential organic molecules, which are involved in the maintenance and…
Q: 2. Cells often use the same enzyme reaction pattern for analogous metabolic conversions. For…
A: A metabolic pathway is defined as a group of actions along with the interactions that lies between…
Q: How do you compare and contrast the structures between protein and carbohydrates?
A: Biomolecules are carbon-based organic compounds. Biomolecules are primarily made up of carbon,…
Q: Q2. How many ATPs are lost in the oxidation of this fatty acid because it is poly- unsaturated? In…
A: First lets calculated total ATP yield if this 18C fatty acid (FA) was completely saturated. 2 ATP…
Q: How does the DNA hold information?
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil around each…
Q: Is there a significance in studying the gene structure? Why or why not?
A: Gene is basic heridity unit organisms from which parental characteristics transfer to their childs…
Q: The major pathway of ammonium assimilation combines two reactions in organisms with rich nitrogen…
A: Introduction: Nitrogen is cycled between organisms and inanimate environments. The principal…
Q: Select all the true statements about sequential versus concerted models of allostery. Group of…
A: Allostery is a property of biological molecules of transmission of the effect of binding from one…
Q: 1. Where is insulin synthesised and in what form is it stored in the body? 2. Describe the mechanism…
A: Insulin is a peptide hormone composed of 51 amino acids. Insulin is the hormone, which regulates the…
Q: Question # 1: A shampoo bottle lists "partially hydrolyzed protein" as one of its ingredients. What…
A: Almost every hair product on the market today contains protein in some way or another. Protein…
Q: translation to the plasma membrane
A: Translation is a process in which mRNA is decoded into short peptide sequences made of amino acids.…
Q: Fibrous proteins, globular proteins, and conjugated proteins are the three (3) primary kinds of…
A: Proteins which are most essential part of diet they are building block of body . Protein named by…
Q: In a study, an undergraduate student discovered a new enzyme involved in the metabolism of…
A: Enzymes are usually protein molecules which catalyzes several biochemical reactions. It works as a…
Q: Whatarethewater-solublevitamins?Describeeachandtheirsources.
A: Introduction: Vitamins are organic compounds required in the diet in minimal amounts to perform a…
Q: Write a possible mRNA base sequence that would lead to the production of this pentapeptide. (There…
A: mRNA is the abbreviation for messenger RNA, a type of single-stranded RNA involved in protein…
Q: Draw the Haworth Projection or the cyclic structure of the following:
A: organic compound organized in the form of aldehydes or ketones with multiple hydroxyl groups coming…
Q: opinion should be the definite characteristic
A: Life of any organism can be beneficial or harmful depends upon the nature of an organism.
Q: 1. A student, halfan hour after the dinner, containing about 150 g of carbohydrates, 20 g of fat,…
A: Fats are glycerides (mono, di and tri), sterols, phospholipids and free fatty acids. it is stored in…
Q: Which THREE statements are true about targetting proteins to the nudieua? Aln the cytoplasm, a…
A: Nuclear localization signals mediates the transport of proteins from the cytoplasm into the nucleus.
Q: The lipase substrate emulsion contains 0.500 mg of olive oil per 3 mL Also, the molar mass of the…
A: The number of moles of a substance is calculated by using the equation, n=mM, where, "n" is the…
Q: What is a folin-ciocalteau reagent and how can it be used to determine the concentration of uric…
A: Uric acid is the end product formed by the catabolism of purine bases. The normal range of uric acid…
Q: What amino acid side chains can be modified by methyl groups? What is unusual about methyl group…
A: What amino acid side chains can be modified by methyl groups? Answer: Methylation is a process of…
Q: 3. The overall result of glycolysis can be summarized by the equation on the right in which the…
A: Glycolysis is oxidative metabolism of glucose molecule by formation of pyruvate which enters into…
Q: 1. One of the following is the simplest phosphoglyceride. a.Phosphatidylcholine b.Phosphatidic acid…
A: Fatty acids are important micromolecules which combine together to form lipids in plants, animals…
Q: Which of the two carbon sources, glucose or acetate, is more advantageous for the cultivation of…
A: E.coli - Escherichia coli, it requires a carbon source to grow to serve as substrate for the…
Q: Which protein standard curve would you use to read off the protein concentration of an unknown…
A: Proteins are composed of twenty standard amino acids attached together via peptide bonds. Protein's…
Q: List possible glucogenic products of amino acid degradation
A: Aminoacids are classified into two types based on their fate of conversion to glucose or ketone…
Q: For questions #23 - #27 A solution is made by dissolving 6.26g NAOH in 25.2g water. 19. What is the…
A: The number of moles of any compound is found by making use of formula: number of moles=given…
Q: Complete the following chart about PDHK activity by determining if the molecule would be in high or…
A: Pyruvate dehydrogenase kinase stands for (PDHK). This PDHK belongs to the kinase enzyme family.PDHK…
Q: Which of the following is not an example of horizontal gene transfer? the transmission of genetic…
A: A bacteria is a prokaryotic organism of unicellular nature. Bacteria viruses are known as…
Q: do non reducing sugars have reactive anomeric carbon?
A: Introduction: Carbohydrates are polyhydroxy aldehydes or ketones with a molecular formula of CnH2On.…
Q: Do "Enzymatic Browning reaction is intensified with the presence of oxygen?.
A: Introduction Enzymatic browning is a chemical process that we can see in fruits, vegetables etc. .…
Q: List a physiological emulsifying agent produced in the liver. What role does this substance play in…
A: Hepatocytes produce bile, which would then be altered by the cholangiocytes that line the bile…
Q: What is the purpose of the low temperature step in the PCR reaction? a. To allow DNA polymerase to…
A: The denaturation step of PCR is optimized for high temperatures. The annealing step in PCR is…
Q: Show the nucleotide sequence changes that might arise in a dsDNA (coding strand segment GCTA) upon…
A: DNA provides mutagenic bases hypoxanthine and uracil when deaminated by adenine and cytosine…
Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 5 -TGTCCCA-3'…
A: Nucleic acids are the biomolecules composed of nucleotide units. A nucleotide unit is composed of a…
Q: What is the effect of a defective a(1→ 4) phosphatase in Pompe's disease (GSD II)? O Accumulation of…
A: Glycogen Storage Disease type II , also called Pompe's disease occurs to due to the deficiency of…
Q: Aside from gel electrophoresis Give another method to quantify DNA. Explain the concept behind this…
A: DNA quantification is a type of quantification of nucleic acids that is used for the determination…
Q: What are two important compounds that lie at crossroads of major metabolic pathways? Select both…
A: Metabolic pathway engineering in microbial hosts for heterologous biosynthesis of commodity…
Q: acetate buffer works on fumarase activity but tris-maleate buffer does not
A: Fumarase is an enzyme that catalyzes reversible conversion of fumarase to malate in TCA cycle.…
Q: Question 13 Which of the following can determine location of glysosidic linkages? O Polarimetric…
A: A glycosidic linkage or bond is a type of covalent bond that joins the carbohydrate or sugar…
Q: Acidosis is a human body disorder caused by too much acid in the stomach. If a patient was tested…
A: Acidosis is a condition in which the body's fluids contain an abnormally high level of acid. It is…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- 1. Fill in the blanks in the table below regarding the similarities and differences between DNA replication and transcription. DNA replication Transcription Polymerase moves along DNA template from 5' to 3' or 3' to 5'? What is the molecule synthesized? Is primase required? (Yes/ No) Polymerase has 3' to 5' exonuclease activity? (Yes/ No) Is the molecule synthesized complementary to the template? (Yes/ No)6. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3'-TACT GACTG ACGAT C-5'. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid sequence (indicating the N and C termini). What type of mutation is each? 6.a. Mutated DNA Template Strand #1: 3'-TACTGTCT GACGATC-5' Complementary DNA sequence: mRNA sequence transcribed from template: Amino acid sequence of peptide: Type of mutation: 6.b. Mutated DNA Template Strand #2: 3'-TACG GACT GAC GATC-5' Complementary DNA sequence: mRNA sequence transcribed from template: Amino acid sequence of peptide: Type of mutation:6. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3'-TACT GACTG ACGAT C-5'. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid sequence (indicating the N and C termini). What type of mutation is each?
- 1. The diagram below depicts an active transcription bubble after a short period of RNA synthesis during the transcription process of a prokaryotic gene. Redraw the diagram and label parts (i) to (v) on the diagram. Motivate your answers. (i) the template and the non-template strands; (ii) the orientation (direction) of both DNA strands and that of the newly synthesised RNA strand; (ii) the location of a possible promotor sequence; (iv) the location of a possible Shine-Dalgarno sequence; (v) the specific area of activity of a RNA polymerase.3. Shown below is a double-stranded bacterial (E. coli) DNA sequence coding for a hypothetical protein. Both strands are shown; the top strand reads 5' to 3' left to right, while the bottom strand reads 5' to 3' right to left. The nucleotides are numbered 1 to 100. NOTE: For this problem, transcription begins with and includes the red and underlined C/G (top strand/bottom strand) base pair and RNA polymerase proceeds from left to right along the DNA. 1 20 40 5'-GTGTCCGTСТААТАТТGTGAGATGTТАТАТСССGCСGTCAАСАССАТСАА-3' +------- +------- ---------+ 3'-САСAGGCAGATTATAACAСТСТАСААТАTAGGGCGGCAGTTCTGGTAGTТ-5' 60 80 100 5'-ACAGGATAATCGCCTGCTGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGCC-3' ------+ 3'-TGTCCTATTAGCGGACGACCCCGTTTCCGCCACTTCCATTTCCACAACGG-5' a) Which strand is used as a template for transcription, the top or the bottom? b) Where would the promoter be relative to the start of transcription? c) What are the first 15 nucleotides of the resulting mRNA? Indicate the 5' and 3' ends of the mRNA. d) What…6. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’-T A C T G A C T GA C G A T C-5’. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence, then transcribe (indicating 5’ and 3’ ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid sequence (indicating the N and C termini). What type of mutation is each? 6.d. Mutated DNA Template Strand #4: 3’-T A C G A C T G A C T A T C-5’Complementary DNA sequence:mRNA sequence transcribed from template:Amino acid sequence of peptide:Type of mutation: 6.a. Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’Complementary DNA sequence:mRNA sequence transcribed from template:Amino acid sequence of peptide:Type of mutation: 6.b. Mutated DNA…
- How many statements are right? 1. operator is a protein (transcription factor) that interacts with a DNA sequence immediately downstream the promoter region 2. Type I restriction endonucleases cleave DNA at specific sites, close to recognition sequence 3. Type II restriction endonucleases cleave DNA within or at short specific distances from the recognition site 4. Type IIl restriction endonucleases Cleave DNA at random sites, cleave DNA near the recognition sequence 5. Type IV restriction endonucleases: Target only methylated DNA 3. 1 2. 4. 5.Some Events that May Occur during Transcription 1. RNA polymerases detach. 2. DNA polymerases detach. 3. DNA polymerases proofread. 4. RNA double helix is unzipped. 5. DNA double helix is unzipped. 6. DNA double helix forms again. 7. MRNA is built in the 3' to 5' direction. 8. MRNA is built in the 5' to 3' direction. 9. RNA ligase fuses the Okazaki fragments. 10. RNA polymerase binds to the sense strand. 11. DNA polymerase binds to the sense strand. 12. RNA polymerase binds to the antisense strand. 13. DNA polymerase binds to the antisense strand. Listed in sequence, the events involved in DNA transcription numbered above are1. Draw a DNA helix opened up to copy a single gene (CAREFUL this is NOT a replication bubble). You can make lines straight and parallel if you would like 2. On the bottom strand starting in middle and pointing to the left, draw a 90 degree arrow to show the start of transcription. 3. Add 10 DNA bases of your choice (A,T, C or G) along the bottom line to left of the 90 degree arrow. 4. Add the complementary DNA bases along the top line. 5. Beginning at the 90 degree arrow, transcribe the DNA into RNA. Write the appropriate letters. Label this as mRNA 6. Label 5' and 3' ends of all nucleic acids. 7. Label the template strand and the coding strands of DNA. 8. Label the promoter. (Upload steps 1-8 but on your own please practice all 4 possible flips of this. Arrow on bottom facing left or right. Arrow on top facing left or right.)
- several options can be correct Consider the following segment of DNA, which is part of a linear chromosome: LEFT 5’.…TGACTGACAGTC….3’ 3’.…ACTGACTGTCAG….5’ RIGHT During RNA transcription, this double-strand molecule is separated into two single strands from the right to the left and the RNA polymerase is also moving from the right to the left of the segment. Please select all the peptide sequence(s) that could be produced from the mRNA transcribed from this segment of DNA. (Hint: you need to use the genetic codon table to translate the determined mRNA sequence into peptide. Please be reminded that there are more than one reading frames.) Question 6 options: ...-Asp-Cys-Gln-Ser-... ...-Leu-Thr-Val-... ...-Thr-Val-Ser-... ...-Leu-Ser-Val-... ...-Met-Asp-Cys-Gln-...2. What is the difference between the old and the new DNA strands? 3. What process invoives the production of MRNA using DNA as template? 1. In the Central Dogma, what process involves the production of a new DNA strand using an old DNA strand as blueprint or template? * How is replication different from transcription in terms of product? 5 What do you call each triplet code made up of three linearly arranged nucleotides in the MRNA? 6 What is the complement of the mRNA tripiet code in the tRNA? 7 In what way is tRNA different from MRNA? 8 In what ways are RNA and DNA similar? 9. In what ways are they different?Some events that may occus during transcription 1. RNA polymerases detach 2. DNA polymerases detach 3. DNA polymerases proofread 4. RNA double helix is unzipped 5. DNA double helix is unzipped 6. DNA double helix forms again 7. Free nucleotides in the nucleus bond to exposed nucleotides of the senes strand 8. Free nucleotides in the nucleas bond to eposed nucleotides of the sense antisense strand 9. RNA ligase fuses the Okazaki fragments 10. RNA polmerase binds to the sense strand 11. DNA polymerase binds to the sense strand 12. RNA polymerase binds to the antisense strand 13. DNA polymerase binds to the antisenes strand List in sequences the events involoved in DNA transcription numbers above are ______, _______, ________, ______, and ________
