1. Hypertrophic cardiomyopathy (HCM) is an inherited disease, characterized by severe chest pain, difficult breathing, palpitations and exercise limitation. Mutations in a cardiac actin gene (ACTC) have been reported to be the basis for this disease. Several studies have shown that ACTC mutations are missense mutations in the nucleotide binding pocket of the actin protein. Provide a scientific explanation why the above mutations in the cardiac actin protein would affect its function.

1. Hypertrophic cardiomyopathy (HCM) is an inherited disease, characterized by severe chest pain, difficult breathing, palpitations and exercise limitation. Mutations in a cardiac actin gene (ACTC) have been reported to be the basis for this disease. Several studies have shown that ACTC mutations are missense mutations in the nucleotide binding pocket of the actin protein. Provide a scientific explanation why the above mutations in the cardiac actin protein would affect its function.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter16: Regulation Of Gene Expression

Section: Chapter Questions

Problem 13TYK

See similar textbooks

Similar questions

4. Figure shows a part of the sequence alignment of human and whale myoglobin proteins. Please explain the difference between green- and yellow-colored mutations. Which mutations have higher probability to change the function of protein, why? Number 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 K|V|E|A|D |||P|G|H|G|Q|E|V|L|| |K| V |E| A|D| v | A |G Human Whale H. G|Q|D|||L|| Number 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 RLFKGHP |R|L|F|K|S | H| P | E |T|L | E |K| F |D| R E|T|L|E|K| F |D|K] Human Whale Number 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 FKHLKSED FKH MK EMK ASED SED Human Whale LKTE A A.
A point mutation is a mutation that arises when one nucleotide in the genetic sequence is substituted, added or deleted. Two possible point mutations are given below: Mutation A. Lysine is substituted for Leucine Mutation B: Serine is substituted for Threonine Which mutation is likely to be more serious? E Explain
33. Band 3 protein exists as a 95-kDa multipass membrane protein that functions as the primary anion exchanger in erythrocytes. Within the red blood cell (RBC) membrane, band 3 binds to spectrin dimers and tetramers indirectly through ankyrin. The spectrin tetramers are bound together by actin and band 4.1 protein, which also binds to band 3 and glycophorin. Null mutations in band 3 occur in the human population. Which one of the following is most likely to decrease in the absence of band 3 protein? a. Osmotic fragility b. Destruction of RBCS in the spleen c. Bile production d. Erythroid production in the bone marrow e. Blood pH
2) Myoclonal epilepsy and ragged red fiber disease (MERRF) is a human condition named for the ragged red fibers of skeletal muscle cells and myoclinic epilepsy in affected individuals. People with this disorder have a mutation in a mitochondrial gene for a tRNA, specfically that for lysine. Why are affected individuals always heteroplasmic?
10. Distinguish between:- a. Glycoproteins and Proteoglycans. b. SIRNA and MiRNA List the various types of eicosanoids. Explain their importance in the human body. What are co-enzyme, isoenzymes and functional plasma enzymes? Discuss the profile of enzyme and isoenzymes in myocardial infarction. What are the different structural organizations during packaging of DNA in a eukaryofic cell? What is meant by denaturation of DNA? Define hyperchromicity of denaturation? What are extracellular matrix proteins? List their functions. How has fluorescence microscopy contributed to one understanding of the nature of cytoskeleton? a. Nanoparticles and their applications b. Molecular chaperones What are heterotrimeric and monomeric G-proteins? Discuss their functions. Describe the effect of the following molecules on electron transport chain. a. Thermogenin b. Oligomycin c. Atractyloside d. BAL a. Briefly discuss Ramchandran plot. b. What is quaternary structure of proteins? Mention the role of…
10. Distinguish between:- a. Glycoproteins and Proteoglycans. b. SIRNA and MiRNA List the various types of eicosanoids. Explain their importance in the human body. What are co-enzyme, isoenzymes and functional plasma enzymes? Discuss the profile of enzyme and isoenzymes in myocardial infarction. What are the different structural organizations during packaging of DNA in a eukaryofic cell? What is meant by denaturation of DNA? Define hyperchromicity of denaturation? What are extracellular matrix proteins? List their functions. How has fluorescence microscopy contributed to one understanding of the nature of cytoskeleton? a. Nanoparticles and their applications b. Molecular chaperones What are heterotrimeric and monomeric G-proteins? Discuss their functions. Describe the effect of the following molecules on electron transport chain. a. Thermogenin b. Oligomycin c. Atractyloside d. BAL a. Briefly discuss Ramchandran plot. b. What is quaternary structure of proteins? Mention the role of…
Mutations in the ribosomal protein gene RPS19 have been found to be associated with Diamond-Blackfan anemia (DBA), a rare syndrome that disrupts erythropoiesis, the process by which new red blood cells are produced. Which of the following provides the most likely explanation for the connection between a mutation in RPS19 and a disruption in erythropoiesis? A B с D The ribosomes in the cell are unable to package and transfer the components that are required for erythropoiesis. The ribosomes in the cell are unable to facilitate the movement of nutrients that are re- quired for erythropoiesis across the cell membrane. The ribosomes in the cell are unable to correctly synthesize the proteins that are re- sponsible for erythropoiesis. The ribosomes in the cell are unable to effectively produce the ATP that is required for erythropoiesis.
8. Which of the following amino acids in hemoglobin accepts proton H+ when red blood cells reach tissues? A. Histidine B. Aspartate C. Asparagine D. Glutamine E. Serine 9. Which region (A to D) of the DNA strands shown can serve as the template for transcription of the region of an mRNA that contains the initial codon for translation of a protein with 300 amino acids? B 5' AGATGCCCТАAGGTCATTGTT 3' 3' TCTACGGGATTCCAGTAACAA 5' C A. Α В. В С. С D. D E. None of the above
Which of the given disorder can be seen in an individual when the mutation includes substitution of a purine by pyrimidine? 1. Chronic myelogenous leukemia 2. Sickle cell anaemia 3. a thalassemia 4. B thalassemia
Consider the genes that specify the structure of hemoglobin. Arrange the following events in the most likely sequence in which they would take place.a. Anemia is observed.b. The shape of the oxygen-binding site is altered.c. An incorrect codon is transcribed into hemoglobinmRNA.d. The ovum (female gamete) receives a high radiationdose.e. An incorrect codon is generated in the DNA of ahemoglobin gene.f. A mother (an X-ray technician) accidentally stepsin front of an operating X-ray generator.g. A child dies.h. The oxygen-transport capacity of the body is severelyimpaired.i. The tRNA anticodon that lines up is one of a typethat brings an unsuitable amino acid.j. Nucleotide-pair substitution occurs in the DNA of agene for hemoglobin
1. True or false for these statements: a. ubiquitin molecule signals that a protein is ready to be transported to the endoplasmic reticulum b. In the ribosome during translation, the incoming tRNA will transfer its amino acid to the outgoing tRNA c.Folding of nascent or new proteins occurs after the full-length polypeptide chain has been separated from the ribosome after translation d. A signal peptide may or may not be degraded once it has guided the polypeptide to the endoplasmic reticulum
1. How would the following affect BOTH transcription and translation of a particular multi- exon gene in a eukaryotic cell (for each address both transcription and translation of a particular multi-exan gene; also treat each independently): A mutation abolishing kinase activity in TFIIH a. b. A mutation abolishing mRNA binding in the snRNP U1 С. A mutation in aminoacyl tRNA synthetase for isoleucine such that it can't bind ATP (assume there is an isoleucine in the code)