1) The UR operon which is composed of sequences A, B, C, and D (which may or may not be genes of regulatory sequences), encodes enzymes 1 and 2. Mutations in sequences A, B, C, and D have the following effects listed in the table below. A plus sign (+) indicates that the enzyme is synthesized and a minus sign (-) indicates that the enzyme is not synthesize. Mutation in UR present UR absent sequence Enzyme 1 Enzyme 2 Enzyme 1 Enzyme 2 No Mutation + + A + В + + + + A) Is the UR operon inducible or repressible? B) Indicate which sequence (A, B, C, or D) is part of the following components of the operon: a. Regulator gene_ b. Promoter с. Structural gene for Enzyme 1 d. Structural gene for Enzyme 2_

1) The UR operon which is composed of sequences A, B, C, and D (which may or may not be genes of regulatory sequences), encodes enzymes 1 and 2. Mutations in sequences A, B, C, and D have the following effects listed in the table below. A plus sign (+) indicates that the enzyme is synthesized and a minus sign (-) indicates that the enzyme is not synthesize. Mutation in UR present UR absent sequence Enzyme 1 Enzyme 2 Enzyme 1 Enzyme 2 No Mutation + + A + В + + + + A) Is the UR operon inducible or repressible? B) Indicate which sequence (A, B, C, or D) is part of the following components of the operon: a. Regulator gene_ b. Promoter с. Structural gene for Enzyme 1 d. Structural gene for Enzyme 2_

Name: 1) The UR operon which is composed of sequences A, B, C, and D (which
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 1) The UR operon which is composed of sequences A, B, C, and D (which may or may not be genesof regulatory sequences), encodes enzymes 1 and 2. Mutations in sequences A, B, C, and D havethe following effects listed in the table below. A plus sign (+

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter14: Gene Regulation

Section: Chapter Questions

Problem 11TYU

See similar textbooks

Similar questions

A number of mutations affect the expression of the lac operon in E. coli. The genotypes of several E. coli strains are shown below. ("+" indicates a wild-type gene with normal function and "-" indicates a loss-of-function allele.) Please predict which of the following strains would have the lowest beta-galactosidase enzyme activity, when grown in the lactose medium. Orpt o* z* r* Orpt ot z* Y OrptoztY Orrotzr OrPotz*Y
You are studying an operon containing three genesthat are cotranscribed in the order hupF, hupH, andhupG. Diagram the mRNA for this operon, showingthe location of the 5′ and 3′ ends, all open readingframes, translational start sites, stop codons, transcription termination signals, and any regions thatmight be in the mRNA but do not serve any of thesefunctions.
The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairing
Consider the following simple regulatory pathways. Assume the full pathway is shown. A- E- B- F- C- G- D- 1 A H- 2 B || L You identify several null mutations (a complete deletion of the gene). For each mutant (indicated with a - sign), determine whether the final product (I, J, K or L) is inducible, uninducible, or constitutive. 3 C 4 D inducible inducible constitutive uninducible constitutive inducible inducible E uninducible F G H > I > J K
Consider the following simple regulatory pathways. Assume the full pathway is shown. A- E- B- F- C- G- D- 1 H- A You identify several null mutations (a complete deletion of the gene). For each mutant (ind with a - sign), determine whether the final product (I, J, K or L) is inducible, uninducible, or constitutive. 2 B 3 C 4 D inducible inducible constitutive uninducible constitutive inducible inducible E uninducible F G H > > >
Suppose that you have isolated a mutant strain of E. coli inwhich the lac operon is constitutively expressed. To understandthe nature of this defect, you create a merozygote in which themutant strain contains an F′ factor with a normal lac operonand a normal lacI gene. You then compare the mutant strain andthe merozygote with regard to their β-galactosidase activities inthe presence and absence of lactose. You obtain the followingresults:
The following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′
O The lac operon in E.coli encodes enzymes necessary for the breakdown of lactose. For each enzyme (lac Z and lac Y), indicate with a + or-whether or not it is made when there is no lactose or when there is lactose. B-galactosidase (lac Z) No Lactose Permease (lac Y) Lactose Lactose No Lactose Genotype PP0 Z Y/I P*O*Z•Y* I'POCZ Y*/I P* O©Z*Y° P O Z'Y/I P'OʻZ'Y* PP O ZY*/IP*O*Z*Y* IP OCZ Y /I P*O*Z•Y* IPO ZY*/I* P*O©Z*Y• I'PO*Z Y*/IP'O*Z*Y°
A number of mutations affect the expression of the lac operon in E. coli. The genotypes of several E. coli strains are shown below. ("+" indicates a wild-type gene with normal function and "-" indicates a loss-of-function allele.) Please predict which of the following strains would have the highest beta-galactosidase enzyme activity, when grown in the lactose medium. O CAP+ r* p* o* z O CAP* I P* o* z* O CAP* r* P O* z* O CAP I P* O z*
Consider the following simple regulatory pathways. Assume the full pathway is shown. A- E- B- F- C- G- D- 1 A H- 2 B || L You identify several null mutations (a complete deletion of the gene). For each mutant (indicated with a - sign), determine whether the final product (I, J, K or L) is inducible, uninducible, or constitutive. 3 C 4 D- [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] E [Choose ] F G I H || J K
Given the following genotypes, explain, by answering the questions in each number, how the mutation (identified by a (-) superscript) will affect E. coli grown in lactose medium. Will there be a complete set ofgene products? (Yes/No) Will the lac operon be turnedon/off? Will the cell survive? (Yes/No) a. i + p + o + z - y + b. i + p - o + z + y + c. i + p + o - z + y +
The lac operon consists of three structural genes, lacZ, lacY and lacA that are transcribed as a single polycistronic mRNA. You are given a new strain of Escherichia coli with the following lac operon genotype: p+0°Z•Y*A +// P*O*Z*Y+ A- (i) Explain how the lac I ³ gene affects gene expression.