0.50 0.25 m 0.2 0.50 mt A. 1. If you are going to compare the graph with the Electromagnetic spectrum, which wave (Wave A or Wave B) will most likely be comparable to red light? Write your answer in the box below. Wavelength in meters (m) 10 10 10" 10 10 10 10 10 10 10 10 10 10 IR Radio waves Visible light 500 400 (violet) 600 700 Wavelength in nanometers (nm) (red)
Q: A principal shell with a value of n=3 would contain s,p,d, and f orbitals true or false
A: A principal shell is indicated by the principal quantum number.
Q: a) Identify the following as element (atomic or molecular), compound or mixture. b) Explain your…
A: An atom of a element is composed of a single nucleus with a unique number of protons surrounded by…
Q: What are the similarities between magnetron and klystron
A: Magnetron It is a high-powered vacuum tube. It is a self-excited microwave oscillator. Klystron It…
Q: Typical frequencies for several types of electromagnetic radiation are given below. Calculate the…
A: The waves of electromagnetic filed causes electromagnetic radiations. These waves propagate through…
Q: Which of the following wavelengths in the electromagnetic spectrum has the most energy? a.…
A: Wavelength is considered as the distance between two consecutive crests and troughs.
Q: 8 7- 6- 2- 1 405 180 225 270 315 [Substrate] (nM) 45 90 135 360 450 495 540 58! What are the units…
A: Solution Michaelis menten kinetics is one of the best models of enzyme kinetics. Value of…
Q: why lung and soft tissue appear different on a radiograph when they have both an effective atomic…
A: The radio graphic image will appear according to the effective atomic number.
Q: Calculate these masses.
A: A large amount of unspecified size is known as mass. It is denoted as m. The amount of space an…
Q: What do you call to the unit amount of a substance used for measuring large quantities of very small…
A: The mole (particularly millimoles and molarity) is a commonly used unit in medicine. For example,…
Q: The magnesium electron spectrum has a line at 266.8 nm. Does it have a greater speed in a vacuum (an…
A: Electromagnetic radiation is a form of energy also known as light. Light travels at speed of 3,00,…
Q: For Be-10, find the: a.) mase defect (in grams) b.) binding energy in kilojoules per mole. mass…
A: The difference between the assumed mass of the nucleus of the atom and the actual mass of the atom's…
Q: Heliox is a helium‑oxygen mixture that may be used in scuba tanks for divers working at great…
A: Boyles law states that at a constant temperature, the pressure of a gas is inversely proportional to…
Q: What element does not react with other elements? Group of answer choices A. hydrogen B. helium C.…
A: Noble gases These are group 18 elements of the periodic table. They are usually chemically inert.…
Q: Which of the following is not an equivalent to ppm? a.mg/L b.ug/g c.g/ton d.uL/mL x 106
A: The abbreviation of ppm is ‘parts per million'. It is also expressed as milligrams per litre (mg/L).…
Q: THE RAYS WITH A WAVELENGTH OF 760-1500 nm ARE 1. visible part of the solar spectrum 2. short-wave…
A: The entire distribution of electromagnetic radiation according to frequency or wavelength is called…
Q: The atomic emission spectrum for a particular element includes blue-violet light with wavelength…
A: The emission spectrum of a chemical element is the spectrum of frequencies of electromagnetic…
Q: Which of the following forms of electromagnetic radiation has the highest energy? Radio waves…
A: The energy states of electromagnetic radiation is directly proportional to the wavelength of the…
Q: Write balanced nuclear equations for the following:(a) β⁻ decay of sodium-26(b) β⁻ decay of…
A: Radioactive decay is the process by which an unstable atomic nucleus loses energy by radiation.…
Q: Assume that you list the following types of electromagnetic radiation in order of increasing…
A: Radiation refers to the energy that travels and spreads as it moves. The waves of the…
Q: What wavelength is most suitable for quantitative analyses for an analyte exhibiting the UV-Vis…
A: Quantitative analysis is the method of determination of concentration of an analyte where teh amount…
Q: What are the names of the elements that we can not analys
A: ICP-OES : Inductively coupled plasma-optical emission spectroscopy. It is an analytical technique…
Q: There are three different types of spectroscopic analyses which are utilised in atomic spectroscopy.…
A: The interaction between electromagnetic radiation (light) and matter as a function of the radiations…
Q: Please help me find the structure based on this IR graph and a boiling point of 90-100°C. 84 80 70-…
A: Different types of spectroscopy can be used to identify the structure of the unknown compound. Some…
Q: determine the density of a metal that has a mass of 2.17g and a volume of 0.35 cm^3
A: The unit of density is gm/cm3 .
Q: . An analysis water from well No 9 of the Manhattan beach, California, water composition showed :…
A: Here the cations are: Calcium, Magnesium, Potassium, Sodium here the anions are: Silica,…
Q: 39. A salt solution of 50.0% sodium chloride (salt) consists of how many parts per million (measured…
A: INTRODUCTION Answer of question 39 is explained below.
Q: How many collisions does single Ar atom make in 1.0 s when the temperature is 25 degrees Celsius and…
A:
Q: An isotope of sodium (Na) has a mass number of 22. How many neutrons does it have?a. 11b. 12c. 22d.…
A: Isotopes are members of a family of an element that all have the same number of protons but…
Q: Discuss the operation of a magnetron vs klystron
A: The klystron is used in TV transmitters, RADARs and particle accelerators. It is also used as a high…
Q: 95.859 The mass of the object is 95.85 grams The weight of the object is 95.85 grams The mass of the…
A: There are several measurement instrument that are used in the laboratory to measure different types…
Q: Which of the following setups would give the formula mass of Ca(PO3)2 in amu? 40.08 amu +…
A: AMU is an atomic mass unit.
Q: Direction: Match the following isotopes by tracing a line in column A to its uses in column B. Iron…
A: Isotopes are atoms of the same element that contain an identical number of protons, but a different…
Q: Notice that the difference between the freezing and boiling point of water is 180 degrees in the…
A: The temperature of a body is measured using different scales such as Celsius, Fahrenheit and…
Q: water 4.18 ethyl alcohol 2.44 benzene 1.80 sulfuric acid 1.40 ased on the information in the table,…
A: INTRODUCTION One of water's most significant properties is that it takes a lot of energy to heat it.…
Q: Define the terms below i. Radioisotope ii. Decay series iii. Radioactive decay energy and its units…
A: 1. Radioisotope: It is an unstable form of a chemical element that releases radiation as it breaks…
Q: What is the energy of the X-ray photon emitted by a tungsten atom in the transition from an L- shell…
A: The K, L and M shell electron binding energies of Tungsten are as follows K shell binding energy =…
Q: Using the figure, answer the following questions.a. What is the molar composition of the vapor in…
A: The horizontal lines denote constant temperature. The curve at point x denotes liquid having mole…
Q: Iodine has 37 known isotopes. Therefore, the atomic mass has a range of 108-144 amu. Which of the…
A: Iodine is a trace element that is naturally present in some foods, added to others, and available as…
Q: Which of the following are uníts for wavenumber in IR spectroscopy? O cm 1 cm O Js1 mm O J-s
A: Wavenumber is defined as the number of wavelengths per unit distance, in centimeters (cm−1) IR…
Q: The freezing point of water is 0.00°C at 1 atmosphere. A student dissolves 10.56 grams of aluminum…
A: molality = weight of solute*1000/gram molecular weight of solute* weight of solvent in g =…
Q: How many spectral lines do you expect to see in a IR spectrum for NO2 and CO2? Considering…
A: IR spectroscopy is a type of spectroscopy that detects the light absorption by a compound. This…
Q: 5. n5° of 2-chloro-2-methylpropane is 1.3850. If a 1 g sample of 2-chloro-2-methylpropane was…
A: * = it is indicating the sign of multiply (✖)
Q: Besides 1H NMR, FT-IR, melting point, data for refractive index, what other information could you…
A: The purity of any compound is the measure of the extent to which a given substance is pure in its…
Q: Chemistry 4. A patient with febrile illness is instructed to administer metemizole sodium. This…
A: Drug calculation is a important aspect in calculating the dose based on the BMI ,BSA ,age and body…
Q: How many H2O particles were produced by creating the following structure? R H R R -N-Ç, H-N-C,- H H…
A: Extention of a polypeptide chain is a typical dehydration reaction where OH from carboxyl group and…
Q: How can you tell in an IR spectrum if the compound has just one or two oxygens? What is the…
A: Infrared Spectroscopy or IR spectroscopy is the study and measurement of interaction between the…
Step by step
Solved in 2 steps
- les/test/tq.php?testid=2804&strandid%3D&element%3D&difficulty=assessment&assignment_id%3D45196931&load_test%-D1&teacherPr B Brainly.com-For st.. O Instagram N Netflix a Escape Room (Und. USATestprep, LLC - E Google Docs Stu wrerhd.cells at rer rote due to the siiple diffsion of Save C) 01ann suan an sianua LUPInaPLiaipaih ep snan aun aAPa IM JaPAA active transport. Glucose molecules will move from the cells into the solution in the beaker D) through facilitated diffusion. When examining the major macromolecules in the cell, a student isolates two molecule types that are directly responsible for cellular energy. A comparison of which molecule types will be most likely to include the molecules primarily responsible for cellular energy? A) proteins and lipids B) carbohydrates and lipids proteins and carbohydrates D) carbohydrates and nucleic acids Proteins and polysaccharides are polymers. These polymers are formed by dehydration synthesis. Which statement correctly identifies a…File guft 1.yt Machine Cochise14ee7 Lane 0 Pmer. DTarPOPD mob Comment 17703 Spacing 15.06 Siga C 17A 4 G 2 Bases 0 an 2004 Gelstat ime123 219 20 30 60 70 NNACTCA TCTOGTGGA TTC CTA TCCTG AC A AG TGATGTG CAAAC TG GTAACTC TG AG GCAGATAAC CA G GG CA AA AAGGTG TATAAG 100 110 140 100 CAGA AG TC CGGA AA A TCA TT TAA 170 TAAA ACA AAGCCCTAACT TG GAAG AAGT TCA GTTTTACACA TCT TTA TA TG GAGAGAA 180 TAT TCTAT TA ATOTCCTGT TA TATT TG TCA TATTCA TA CAGT TGTCACAGTATATT TCAAAC CA AC TG TTTAAAA ACAAAC TO AAATAAA 210 230 240 260 270 AAATTTAAATACCCT TA TG TA AA ATAG GCT TC CC TG GTG GCTCAG GG GTAAAAA ACTCGC CCGC CA ACGCAG GAGATGTAGAT TTGATC CCT 300 310 340 350 410 430 440 GG GT TAG GA AG icCCTa GAGA AGGAAATGAAAAAC CACTCTAG TAT TCT Tac CTG GG AAATC CCA TGGACAG AG GAGCOTO GAG G Gc 490 500 SI0 530 TACAGTCCATGGGAGTCGCAA A AGAGT TG GACATG ACTAA ACA ACAACATATAAAATAACCT TACTC CATAATGTCAAACT TATOTCACAC S40 AAA ATGCAA AGT TCT TACATCTAT TAACTTTTATGOT TAAATATA ACCTAATGCACTOTTT TATACAGCA ACAACTACT TT TT TATTT TAAA…3:53 1 + t A 42.0 KB/S 7i ul l 62 chegg.com/homework-h 1 home / study / science / anatomy and physiology / anatomy and physiology questions and answers / asked with an image Your question has been posted. We'll notify you when a Chegg Expert has answered. Post another question. O Next time just snap a photo of your problem. No typing, no scanning, no explanation required. Get Chegg Study App Question: O Edit question Nerve Origin Movements muscles innervated Cutaneous or sensory innervation allary radial Muscilo-cutaneous ulnar median obturator Femoral nerve tibial Common fibular nerves Deep fibular nerve Superficial fibular nerve Sciatic nerve Gluteal nerves Pudendal nerves Mioinguinal nerve Lumbosacral nerves Expert Answero This question hasn't been answered COMPANY LEGAL & POLICIES CHEGO PRODUCTS AND SERVICES CHEGO NETWORK About Chegg Chegg For Good College Marketing Mobile Apps EasyBib Internships.com Advertising Choices Cheap Textbooks Cookie Notice Chegg Coupon Sell Textbooks…
- 1B 3/23 DNA/Protein Synt x S le festin song analysis | Scho0 X G what compounds are respons mmon-assessment-delivery/start/4797160920?action3Donresume&submissionld%3D468979669 English 9 Student D.. A Type of Genetics Cr. S TEWWG Chapter 1. ppppppppppppppp. ONA Protein Synthesis Test DNA REPLICATION DNA Replication takes place during v and the end result is 5 67 8 9 10 11 Support Schoology Blog I PRIVACY POLICYO Dashboard I Practice Session - Enzymes - Stu x A app177.studyisland.com/cfw/test/practice-session/ac7b47CFID=127df959-72b2-4aae-99f3-6bed853d6eeb&CFTOKEN=0&cratelD=ac7b48pac O Bookmarks O Dashboard iL Login | Imagine Lea. G Execution of the Ro. K Kami A Actively Learn E Google Docs FF Edtell Sakai Gatew Error M Mathway Basic M. O Reading list Enzymes Tools Save Session 1.0 0.8 0.6 0.4 0.2 20 40 60 80 100 Temperature (°C) Catalase is an enzyme that is found in all living tissues. Cells need catalase in order to function properly. Which of the following statements can be inferred using the above information? O A. Cells can function equally as well at all temperatures because enzymes are effective at all temperatures. OB. Cells only function within a specific temperature range because enzymes only function within a specific temperature range. OC. Cells can function eaually as well at all pH's because enzvmes are effective at all pH's. Session Score: 100% (4/4) Session Timer: 44:44 4 of…Modified True or False: Write CMB if the statement or question is correct. If the statement or question is incorrect write THE CORRECT ANSWER and UNDERLINE, the word/s that makes the statement or question incorrect. " The iodine toot ie ueod to toet forthe procence of otarch. The Denediat'eteet identifice redueing ougars -- 2 Piuret test is a general test for compOunde Sudan III/IV test is used to detect the hydrocarbon chains of lipids. Hwe or more poptide 4. 5. In 1842, Karl Nageli, was the first person who had seen rod-like structures present in the animal cells' nucleus. chromosomes were first studied by Walther Flemming in 1888. 7. 6. Satellite is a knob-like structure at the end of a chromosome that is present beyond the secondary constriction or distal to it. 8. Allosome_is the sex chromosome Karyotyping based on symmetry was formulated by Levitzky in 1941 10. Parm is the shorth part of chromosome An MRNA with many open reading frames is called polycistronic Ideogram is where we…
- wing organe pols schoology.comcommo-assessment-delivery/start/3270652045?action=onresume&submissionid=247318926 Jab Desmos | Testing M KeepVid: download. 9 Schoology It s Elemental - Ele. Play Kahoot! - Ente plogy Bayside Home Page Bayside Home Page Jose puts a drop of food dye into a glass of water and observes the dye forming colorful swirls before eventually turning the water green. This observation can be explained by O facilitated diffusion O active transport O simple diffusion polarity 19 20 21 22 23 24 25 26 27 28A Test - Unit 2B F x E Practice -5. Ec x E Alya Alhashim x E Alya Alhashim x E Alya Alhashim x A examlogin.com/#/virtual_form/7c8d0e46-30d8-11ec-8b04-a772c9f594f9 Morris Bye Element.. Library Search Media services / Ele. E What's Going On in. 6 Bases housing U.S. 4 of 6 + 100% 18. A breeding pair of rabbits escaped from their cage behind a farmer's barn. The farmer observed the rabbits and.kept data on their population size for ten years. During this time, the rabbits reproduced and their offspring reproduced many times. The fenced, undisturbed two acres where the ribbits live support populations of predators, such as hawks and snakes, as well as a limited supply of grass and water. At the end of the ten years, the farmer graphed the data he collected. Which of the following graphs would its population growth look like? Don't pick E, you're welcome. A) E) Time Time D Time Time I am finished azis uoueindo azis uouejndo Population sizeod 1 Meet- zpn-oxtp-bxu Unit 2 test - cells, organelles, mer X G In order to deteminie how cells rx A testing.illuminateed.com/assessment/5f765e7b4c2b2eb5078b7842/5f765e7b4c2b2eb5078b7843/1?rldbqn=1 ail YouTube Maps O News (1) Facebook Launch Meeting - Z... TikTok sues U.S. go... i! Spanish Present Pro... embrane, transport fall 2020 D. Water moves into and out of the cell at the same rate since the cell is isotonic to its environment. 7. In carrying out normal activities, cells use oxygen and produce carbon dioxide. The concentration of oxygen is higher in the blood than inside the cell, so oxygen moves into the cell. Similarly, carbon dioxide moves out of the cell into the blood because the concentration of carbon dioxide inside the cell is greater than the concentration outside the cell. How do the small molecules of oxygen and carbon dioxide move through the cell membrane?
- Bro n-2 1alz ah MB Home Insert Draw Design Layout References Mailings Review Help View St Tahorna 12 A A" Aa - A O Find - AaBbCcl AaBbCcI AaBbC AABBCCC c Replace x A- 2- A- T Normal T No Spac. Heading 1 Heading 2 Dictate Sensitivity Editor A Select pard Font Paragraph Styles 12\ Editing Voice Sensitvity Editor Name: Date: Osmosis and cell membrane A. Use your notes and check the correct box in the chart below: Hypotonic Hypertonic Solution Isotonic STATEMENT Solution Solution 1. The concentration of the solute in the solution is lower than the concentration inside the celI. 2. When a cell is placed in this solution, water will enter the cell by osmosis causing it to swell. 3. The concentration of the solute in the solution is the same as the concentration inside the cell. 4. The concentration of the solute in the solution is higher than the concentration inside the cell. 5. When this solution is injected into the body no cell disruption Occurs because no net osmosis occurs. 6. Putting…Modified True or False: Write CMB if the statement or question is correct. If the statement or question is incorrect write THE CORRECT ANSWER and UNDERLINE, the word/s that makes the statement or question incorrect. The iodine toot ie ueod to toet forthe procence of otarch. The Denediat'eteet identifice redueing ougars 1 Piuret test is a general test for compounde Suden VIVV tost ie used to detect the hudrocarbohains oflipids. 1042, Karl Nageli, was the firet erson wnonad structures present in the animalcolle' puelcus. chremosomesS WOre first studied by vwaluner Hemming in1888 pnded oio JO OMI 5. seen 1od-ike 7. Satellite is a knob-like structure at the end of a chromosome that is present beyond the secondary constriction or distal to it. 8. Allosome_is the sex chromosome Karyotyping based on symmetry was formulated by Levitzky in 1941 10. Parm is the shorth part of chromosome An MRNA with many open reading frames is called polycistronic Ideogram is where we can fully study the…AutoSave 5 Ch.9 Online Guide 5 -Labs 12&PhysEx 2.docx - Saved to this PC - P Search Torres,Erica ff File Home Insert Draw Design Layout References Mailings Review View Help A Share P Comments O Find v - 5 - A^ A Aa v A a- AaBbCcI AaBbCcI AaBbC AaB AaBbCcD Arial O Replace Paste I Normal 1 No Spac. Heading 1 Dictate Sensitivity Editor Reuse В I U v ab x, x' A - evAv Title Subtitle A Select v Files Clipboard Font Paragraph Styles Editing Voice Sensitivity Editor Reuse Files Chart 2- Effect of Stimulus Voltage on Skeletal Muscle Contraction Voltage 0.0 Active Force (g) Voltage 5.0 Active Force (g) 0.2 5.5 0.8 6.0 1.0 6.5 1.5 7.0 99+ 2.0 7.5 2.5 8.0 3.0 8.5 3.5 9.0 4.0 9.5 W 4.5 10.0 Activity Questions 1. For a muscle like the one in this lab, explain the effect of increasing stimulus voltage: 2. How is this effect on a muscle achieved in vivo (in the body) with no electricity of course!? Activity 3- The Effect of Stimulus Frequency on Skeletal Muscle Contraction Be sure to go back to the…