Which of the following reflects sequence elements conserved in pre-mRNA splice sites? (more than one answer) Nucleotides on the 5' side of the intron Nucleotides on the 3' side of the intron Nucleotides in the middle of exon one Nucleotides in the 3'UTR

Which of the following reflects sequence elements conserved in pre-mRNA splice sites? (more than one answer) Nucleotides on the 5' side of the intron Nucleotides on the 3' side of the intron Nucleotides in the middle of exon one Nucleotides in the 3'UTR

Name: Give correct answer and detailed explanation in typed answer(no handwr
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Give correct answer and detailed explanation in typed answer(no handwritten) Which of the following reflects sequence elements conserved inpre-mRNA splice sites? (more than one answer)Nucleotides on the 5' side of the intronNucleotides on the 3' side

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 8TYU: Which of the following is/are typically removed from pre-mRNA during nuclear processing in...

See similar textbooks

Similar questions

Which of the following is/are typically removed from pre-mRNA during nuclear processing in eukaryotes? (a) upstream leader sequences (b) poly-A tail (c) introns (d) exons (e) all the preceding
The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.
Splice sites on mRNAs are located with the help of all of the following EXCEPT: Question 9 options: Small nuclear ribonuclear proteins (SNRPs) Recognition of a GC-rich consensus sequence within the intron Recognition of an AT-rich consensus sequence within the intron Recognition of a GC-rich consensus sequence overlapping an exon on the 5' end Pyrimidine-rich sequences within the intron
The figure depicts what kind of splicing: A sequence change (asterisk) has abolished the acceptor site at the 3' end of intron 1. Exon 2 is skipped A sequence change has abolished the acceptor site at the normal end of intron 2. Instead of skipping exon 3, the spliceosome has found a nearby alternative acceptor-like sequence, a' in intron 2, to use. the three exons are spliced as processed normally A sequence change has activated a cryptic acceptor site, a’ in intron 2. A downstream sequence d' is used as a new donor site, creating a novel extra exon.
Which of the followings indicate the order of procaryotic mRNA degreadation? cleavage of the triphosphate 5′ terminus to yield a monophosphate- 3′ to 5′exonuclease digestion- The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme cleavage of the triphosphate 5′ terminus to yield a monophosphate- The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme- 3′ to 5′exonuclease digestion The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme- cleavage of the triphosphate 5′ terminus to yield a monophosphate- 3′ to 5′exonuclease digestion
A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
Which of the following processing events occur during or after the synthesls of MRNA molecules in eukaryotes? Intron splicing Addition of a 5'cap O Cleavage of multiple functional molecules from a larger precursor O Polyadenylation of the 3' end
A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.
Which of the following polypeptides (written from their N terminal ends) is encoded by the following mRNA? (hint: there is no left or write in a cell!) 3' GG AUG AGU AUA CUU ACG GGU GAA GUA CAU UAA CCC C5' O O O Met Lys Trp Ala Phe lle Met Ser lle Leu Thr Gly Glu Val His Tyr Lys Arg Thr Phe Tyr Met none of the above His Val Glu Gly Thr Leu lle Ser Met
The piece of eukaryotic mRNA below includes the region that codes for the binding site for the initiator tRNA needed in translation. 5'-GUUUCCCGUAUACAUGCGUGCCGGGGGC-3' Using the table below, which amino acid would you expect to be on the tRNA that is the first to bind to the A site of the ribosome? AGC AGA AGG GCA CGA CUA GGA GGC GCC CGC AUA CUC AGU CCA UCA ACA CCC UCC ACC UUC CCG UCG ACG UUU CCU UCU GCG CGG GAC AAC UGC GAA CAA GGG CAC AUC CUG AAA GCU CGU GAU AAU UGU GAG CAG GGU CAU AUU CUU AAG AUG Ala Arg Asp Asn Cys Glu Gin Gly His lle Leu Lys Met Phe Pro Ser O methionine O arginine O cysteine Ovaline UUA UUG OOOO GUA GUC UAC GUG ACU UGG UAU GUU Thr Trp Tyr Val UAA UAG UGA stop