Q: The formation of mRNA from DNA is called translation. transcription.…
A: Question - The formation of mRNA from DNA is called A.) translation. B.)…
Q: Which of the following is not involved in the process of translation? TRNA snRNA All are involved in…
A: Translation can be defined as the process by which RNA is used to make the proteins. The information…
Q: Which of the following step acts before the others in pro ribosome large subunits binds to mRNA TRNA…
A: The translation process completes in three main steps. they are initiation, elongation, and…
Q: Which category of RNA carries amino acids for the process of translation? rRNA snRNA mRNA tRNA
A: Translation is the process of Synthesis of proteins from mrna. This process takes place in cytoplasm…
Q: Which of the following is not directly involved in translation?
A: Translation is the cycle where ribosomes present in the cytoplasm or endoplasmic reticulum blend…
Q: Which of the following is responsible for the ability of one gene to code for more than one type of…
A: During RNA Splicing: Introns -excised and exons - ligated together.
Q: What are the enzymes involved in eukaryotic translation? topic is about: DNA Replication and…
A: Eukaryotic translation Ribosomes normally exists as the seperate subunits that are composed of the…
Q: Which of the following is NOT a part of transcription? O Double-stranded DNA is unwound and forms a…
A: Transcription is the process of copying genes in DNA into mRNA sequence where they form…
Q: Which of the following is NOT found on a mature eukaryotic mRNA molecule? (Choose all that apply)…
A:
Q: During transcription, an mRNA molecule is formed: *( Choose True if the statement is correct abourt…
A: Transcription: The process of making of mRNA from DNA carried out by an enzyme RNA polymerase.…
Q: Which of the following statements regarding transcription is true? Helicase unwinds the DNA helix to…
A: Transcription is the process of formation of sequence of RNA using DNA as a template and DNA…
Q: Which of the following is not a type of RNA?a. nRNA (nuclear RNA)b. mRNA (messengerc. rRNA…
A: Answer- Transcription is the process of formation of RNA. There are majorly 3 types of RNA- mRNA,…
Q: n the process of transcription, the input is and the output is O tRNA, DNA O MRNA, protein O DNA,…
A: the central dogma of molecular biology suggest that biological information flows from DNA to RNA to…
Q: As a gene s information is used to create a protein, which of the following is controlled by other…
A: A gene is the basic physical and functional unit if heredity and are made up of DNA.
Q: Which of the following processes occurs in the nucleus and forms acomplementary copy of one strand…
A: The deoxyribonucleic acid (DNA) is the double-stranded molecule that is the genetic material in most…
Q: Which of these pieces of a gene will ultimately be read by the ribosome to produce a protein?…
A: Pieces of genes introns and exons are actually nucleotide sequence within a gene. There is an…
Q: Which of the following RNA molecules is responsible for carrying the code that will be read at the…
A: BASIC INFORMATION TRANSCRIPTION it is responsible for the formation of hnRNA which has the codes…
Q: Which of the following statements regarding transcription is true? Helicase unwinds the DNA helix to…
A: Each nucleotide comprises three elements in a nucleic acid. One such component is a five-carbon…
Q: Which of the following is true about transcription? O transcription begins at a start codon and ends…
A: Transcription is the process of making RNA from the template strand of DNA. It takes place in the…
Q: Part A Which of the following processes is represented in the figure below? 3' AAG UGA RF1 RF2 O…
A: Thank you for the question Answer :- The given picture shows translation termination Explanation :-…
Q: If a eukaryotic MRNA lacked a poly-A tail, where would the MRNA be located? Cytoplasm Endoplasmic…
A: The stability of mRNAs varies considerably in the case of eukaryotic organisms. Some mRNAs have very…
Q: Which of the following mutations would cause translation to end? O Mutation 1 O Mutation 2 Mutation…
A: Translation is the process where protein gets form. Here the start codon is AUG and the estoppel…
Q: Transcription and translation are separate processes in gene expression; however, they have…
A: In living organisms, the genetic instructions for growth, development, functioning, and reproduction…
Q: Which of the following is unique to eukaryotic mRNA synthesis? O Coupled transcription-translation O…
A: The correct option is Removal of Introns. Explanation: Before it can be translated, eukaryotic…
Q: The job of a ribosome is to: make an mRNA transcript of DNA synthesize a new strand of DNA using the…
A:
Q: Which of the following have codons? amino acids acetyl transferase FRNA RNA polymerase proteins TRNA…
A: The DNA is the genetic material of the living organisms like humans. This molecule carries the…
Q: In which direction does the ribosome move along RNA?
A: Nucleic acids are macromolecules present in each and every cell of living beings. They are mainly…
Q: The ribosome recognizes and binds to the promoter region of DNA to initiate translation. true or…
A: To initiate translation a ribosome , an mRNA and an "initiator" tRNA carrying the first amino acid…
Q: Which of the following statements is true of eukaryotic transcription? Exons are spliced out from…
A: Introduction A genome is consisting of transcriptionally active genes. These genes form RNA…
Q: In the elongation stage of translation, which of the following options is correct? the polypeptide…
A: The Central Dogma of molecular biology refers to the flow of information from DNA to RNA to…
Q: Transcription is a process in which MRNA is synthesized from DNA. MRNA is pro duced from only one…
A: Gene is the sequence of nucleotides that encode a protein. This protein has specific function.
Q: Which of the following step is NOT involved in eukaryotic MRNA synthesis? O Elongation O…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…
Q: Which of the following types of RNA carries the genetic information from DNA in the nucleus to the…
A: Since there are multiple questions in this particular question, I will answer the first one for you.…
Q: Which type of biological molocule is being made during this process? Incoming tRNA Bound NA to Amino…
A: The figure is showing the process of translation. Translation is the process of formation of a…
Q: Energy that drives translation is provided mainly by______ . a. ATP c. GTP b. amino acids d. all of…
A: Translation is the process of protein synthesis using messenger RNA as a template.
Q: Which of the following processes includes the removal of introns in the primary RNA transcripts? O…
A: Introns are noncoding sequences of an RNA transcript or the DNA encoding it. In simple terms,…
Q: In RNA, ___________ pairs with adenine. A.Group of answer choices cytosine guanine thymine…
A: RNA (ribonucleic acid) is a nucleic acid which consists of repeating units of ribonucleotides. A…
Q: All of these materials are needed for translation EXCEPT: a) amino acids b) mRNA c) tRNA d) RNA…
A: Translation occurs in four phases: activation (prepare), initiation (start), elongation (make…
Q: DNA Downstream G Upstream The process illustrated in the figure is: transcription. translation. a…
A: The DNA is a complex double helical strand which is located in the nucleus. Its strands are lined…
Q: If an mRNA nucleotide is synthesized from DNA, how do you identify the: 5’end; 3’ UTR;…
A: The promoter sequence serves as a site for binding of RNA (ribonucleic acid) polymerase. It is…
Q: Which process occurs with tRNA at the ribosomes? translation transcription…
A:
Q: Which form of RNA acts as a blueprint for protein synthesis in the ribosome? a. tRNA O b. rRNA O c.…
A: Introduction Proteins are complex biomolecules and macromolecules that are made up of one or more…
Q: Which of the following statements about the splicesome is correct? The spliceosome controls the…
A: A spliceosome may be a large ribonucleoprotein (RNP) advanced found primarily inside the nucleus of…
Q: of the following determines the amino acid sequence of the protein produced during the process of…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…
Q: Which of the following molecular structures contan codons? a protein B mRNA C. IRNA D. rRNA and C
A: The genetic material contains the genetic information. It passes the information from parents to…
Q: During transcription, the nitrogen base adenine on the DNA bonds with the nitrogen base…
A: Transcription is the process in which the information from a DNA strand is copied to a messenger RNA…
Q: All of the following are involved in transcription excepta) polymerase. b) primer.…
A: Transcription is the process of synthesis of mRNA from DNA. One of the strands of the double…
Q: The job of a ribosome is to: make an mRNA transcript of DNA synthesize a new strand of DNA using the…
A: INTRODUCTION Protein synthesis is the process in which the formation of new proteins takes place. In…
Q: The following set of RNA is required the translation process except one, mark the INCORRECT? * O a)…
A: Translation is the process by which the synthesis of protein occur. Cells are the basic unit of…
Step by step
Solved in 2 steps
- Part A Which of the following processes is represented in the figure below? A 5' ÀÚGÚÚČĞĞŮ 3' AAG UGA UUC RF1 RF2 transcription initiation translation initiation translation elongation transcription elongation translation termination O O OName (Last, First): DNA An RNA polymerase attaches to the DNA and transcribes the DNA to mRNA Ribosone BIO 340 Activity # 1: DNA and the Central Dogma Complete: DNA Coding 5' ATG TGG ATT CTC AAG ATC AAT AGT 3' DNA template 3 5' Cytoplasm Nuckus Nuclear pore ARNA Use the mRNA codon sequence and the genelic Landelable in order to find the amino acid (AA) sequence of the protein. Example: if mRNA sequence is GUU then the corresponding amino acid 3-letter is Valine (Val) and the corresponding amino acid 1-letter is V. mRNA codon 5' FIRST (5') LETTER tRNA codon 3 U AA 3-letter AA 1-letter Amino acid AA - Amino acid A tRNA THE GENETIC CODE New protein being built U Pie (F) ասա UUC) ԼԱՔ Uva) Lou (L) Leu (L) val (M) Use numbers 1 to 3 to indicate the correct order of the flow of biological information. Translation Replication Transcription Hydroxyl group Deoxyribose sugar DNA's charge is negative due to following (circle the correct one): An alpha helix and a beta sheet in a protein are a type…What does it define- defining theprocess of transcription- DNA to RNA The code is nonoverlapping
- 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…Original Mutation 1 Mutation 2 Mutation 3 Mutation 4 DNA Codon TTC ATG TTT TCC ACT mRNA Codon AAG UAC AAA AGG UGA Second letter U UUU] UCU] UCC UAU] UAC Tyr UGC Cys Phe UGU U UUC. UUA1 Leu UUG UCA UCG Ser UAA Stop UGA Stop A UAG Stop UGG Trp CUU CUC CUA CUG CCU CAU CGU CGC CGA CGG His CCC Leu ССА CAC Pro Arg CAA Gin CCG CAG AGU Ser AGC ACU AUU AUC Ile AAU Asn AAC ACC Thr AUA AUG Met ACG AAA1 Lys AGA AGG ACA Arg AAG GAU GCU GCC GGU GGC Gly GUU GAC Asp GUC Val GUA Ala GCA GCG GAAT Glu GAG GGA GGG GUG Third letter UCAGn CAGUCAG UAG First letterRNA Write the mRNA and the polypeptide made from the RNA. Translation DNA Template strand Transcription TTT TT TACGGCGTTAGACAAGTGCGTGAGTACACA ATGCCGCAATCTGTTCACGCACTCATGTGT ▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬||
- w/opCulGACU GAC UC 4C According to the Genetic Code Sheet below, which of the following amino acid sequences corresponds to this MRNA strand? CỤC AAG UGC UUC PHE GLU ASP SER ALA TYR U A STOP A GU VAL U CIS U U G A STOP IG TRP ARG AC U LEU SER UG PRO ASN HIS THE GLN MET ILE ARG O a lys-leu-cys-phe O b glu-cys-pro-phe leu-lys-cys-phe O d leu-glu-leu-val U...pdfProcess of translation True False transfer RNA is made from messenger RNA participation of rRNA includes covalent modification of some proteins tRNA uses information from mRNA to produce amino acid chainsCoding strand CGT CTC TTC GGA CAC whar is the mRna strand
- Name each of the processes pictured: -RNA 5' TCAC CÁCTCAT 3' TACCACCTA 3' UUCAC CACUCAU U 5' DŇA RNA polymerase Primary RNA transcript Exon 1 Intron Exon 2 Intron Exon 3 Spliced RNA 000 Exon 1 Exon 2 Exon 3 AAAAAAA polypeptide chain Met Phe Arg P E UAC AAA GCU AUGUUUCGA Ribosome There are possible nucleotide "triplets" orAssume that you are a RNA polymerase. Which strand is the template strand? -5 ↓ 3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’Which of these is not part of transcription events Polymerase Primer Promoter Sigma factor Uracil