Which is true about eukaryotic cDNA? Choose all that apply a. it is single stranded b. it is made up of only introns c. it is constructed from mRNA that is reverse transcribed d.
Q: Identify the polar and nonpolar parts of the assembly. Identify the pocket and the two bilayers that…
A: Polar components are those that are hydrophilic and soluble in water. Non polar components are those…
Q: tफकाटक ननी वकट नवींणणणणय हैमकजनाययळे प्B fAtzeorgating a) it is mare highly hydrated. are pressture…
A: The hydrophobic interaction is critical for the stability of several bioactive systems and plays a…
Q: Explain what hydrogels are as a group of material. Discuss and illustrate with examples the most…
A: Large molecules which are synthetically made or obtained naturally and are made up of many simpler…
Q: Which patient/s may receive blood transfusion from an AB+ donor based on their blood typing profile?…
A: Given, Patient A is A positive Patient B is B positive AB+ blood can be donated only to AB+ blood…
Q: In Zak-Henley's method in Determination of Total Serum Cholesterol, determine role of the sulfuric…
A: Cholesterol is a type of steroid. The normal serum cholesterol is 125-200mg/dL. Elevated serum…
Q: The peptide below contains how many amino acid residues?
A: The name 'amino acid' is derived from the amine and carboxylic acid groups, and so these two parts…
Q: Which of the following enzyme is responsible for the regulation of biological nitrogen fixation? A.…
A: Nitrogen fixation is biochemical process by which molecular form of nitrogen with triple covalent…
Q: What amino acid side chains can be modified by methyl groups? What is unusual about methyl group…
A: What amino acid side chains can be modified by methyl groups? Answer: Methylation is a process of…
Q: Enumerate and discuss three disorders that could result from the absence of enzymes
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Which undergoes more number of beta-oxidation cycles - degrading a 16:0 lipid or degrading a 16:2…
A: β-oxidation is the process of degradation of fatty acids by the oxidation of βcarbon atoms of the…
Q: b) what is the possible cause of this discase?
A: A tiny tumour in the pancreas that produces too much insulin is known as an insulinoma. The growth…
Q: 1. The allosteric inhibitor of an enzyme a) Causes the enzyme to work faster b) Binds to the active…
A: Inhibitors bind the enzyme and decrease the catalytic activity of the enzyme. The inhibitors may be…
Q: Mechanism for Acid-Base Balance What happens with this mechanism to regulate the body to become more…
A: The bicarbonate/carbonic acid buffer system is found in blood and many other tissues. It balances…
Q: is acetate present in TCA cycle? Are carbon atoms of acetyle-CoA are converted into CO2?
A: The citric acid cycle is an important metabolic process that links sugars, fat, and protein…
Q: Which of the following is NOT a non-carbohydrate material in gluconeogenesis? Choices: Lactate…
A: From the non-carbohydrate source, glucose is synthesized called gluconeogenesis. It is a…
Q: Which of the following factors does not pay for the generation of NADH and ATP during steps 6 and 7…
A: The energy system that breaks down carbohydrates into smaller carbon molecules is known as…
Q: The following unsaturated fatty acids can be found in seminal fluid and act on smooth muscles.…
A: Introduction: Fatty acids are an important source of energy. They all have a carboxyl group at one…
Q: Once the RNA primers are replaced the fragments in the lagging strands are sealed by DNA pol I.…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: We use 3.16 fold dilution why this dilution schedule is important to determine unknown DNA…
A: The dilutions are the geometric series i.e Serial dilutions are prepared using same dilution step as…
Q: Which of the following is not a general description of the gene expression regulation mechanisms…
A: Gene expression regulation mechanisms helps to maintain the rate of gene expression or to regulate…
Q: Sugar is an organic molecule. Most organic molecules are non-polar compounds making them insoluble…
A: A polar molecule is a molecule containing polar bonds having non-zero dipole moments.
Q: Question 11 Match the different carbohydrates' nomenclature/ glycan representation with their…
A: IUPAC-IUBMB, symbol nomenclature, LINUCS, and linear code are different nomenclatures used to name…
Q: Alcohol dehydrogenase is the enzyme that converts alcohols to aldehydes or ketones. Explain how…
A: Alcohol dehydrogenase is the enzyme that converts alcohol into an aldehyde. It is the enzyme that…
Q: What aeration condition (presence or absence of O2) favors cell growth? What is the metabolic…
A: Aeration means the presence of oxygen and anaerobic condition means the absence of oxygen. The…
Q: What percentage of ATP energy is produced when 9.0 moles of glucose are oxidized into acetyl CoA?…
A: Glycolysis generates net ATP = 2 ATP per mole of Glucose molecule Then end product of glycolysis -…
Q: Lipid molecules contain either saturated or unsaturated fatty acids. You may have seen different…
A: A fatty acid is a carboxylic acid with an aliphatic chain.
Q: describe the structural features of protein transaminase/aminotransferases (primary, secondary,…
A: Hi! Since you have posted multiple questions and have not mentioned which to answer , we are…
Q: (d) Identify a wax from the list of compounds shown. ____________ (e) Identify a diglyceride from…
A: The three principal categories of lipids are phospholipids , sterols, and triglycerides.
Q: b) Consider the following experimental results: Total hydrolysis of a nonapeptide gave:…
A: Proteins or peptides are made up of twenty standard amino acids that are attached together via…
Q: Show a chemical reaction involving hydrogen peroxide and the enzyme present in potato. What enzyme…
A: Chemical reactions and processes are sped up by catalysts or chemicals found in all living things.…
Q: 2. Draw out a labeled diagram explaining all the following processes: Gel Filtration Chromatography…
A: Gel Filtration Chromatography: Gel Filtration chromatography is method in which molecules in a…
Q: Saponification is a process by which triacylglycerols are hydrolyzed to produce glycerol and fatty…
A: Triglycerides have a glycerol backbone with the hydroxyl groups esterified with fatty acids.
Q: Key features of signal transduction mechanisms are: specificity, amplification, integration and…
A: Receptors are present in the body. The drug molecules are bound to such receptors and show their…
Q: Use the diagram below to complete the cyclic alpha form of structure V. CH2OH Circle the hemiacetal…
A: The given sugar is D-Galactose. It is the C-4 epimer of glucose. The alpha and beta cyclic forms of…
Q: Five sweetener samples (labelled A to E) were tested by 97 individuals for the intensity of their…
A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…
Q: Blood type O is also known as universal donor because it does not contain plasma antibodies. True…
A: Depending on the presence or absence of antigen or antibodies, the blood has been categorised into…
Q: How can I distinguish between orthosteric, allosteric and cryptic ligand binding sites?
A: A binding site is a specific area on a macromolecule like a protein that binds to another molecule.…
Q: A drug was developed to inhibit the electron transport chain. How many ATP(s) would be generated by…
A: Metabolism includes biosynthesis/ reduction (an anabolic process) and oxidation (catabolic…
Q: - What investigation to differentiate between anemia due to vitamin B12 or folic acid deficiency? is…
A: Vitamin B 12 , is a cyanacobalamin. It is usually produced by the bacteria. There are wide variety…
Q: TRUE or FALSE: Terpenes can be classified as lipids due to its structure that originates from…
A: Terpenes are the naturally occurring molecules, mostly obtained from the plants. They are…
Q: i need the answer quickly
A: The metabolism of carbohydrates, fats and proteins takes place inside the adipocytes. The…
Q: 1. In human diet, all cholesterol comes from Animal products Vegetable products Both A and B None of…
A: "Since you have posted multiple question we will answer the first question for you. If you want any…
Q: Which of the following is NOT one of the products of the pentose phosphate shunt?
A: The pentose phosphate pathway is the one important metabolic pathways which is take place in most of…
Q: draw the full equation for this triacylglycerol undergoing saponification, using KOH.
A: In the process of saponification, triglycerides are reacted with sodium or potassium hydroxide to…
Q: list ALL redox reactions that occur during cellular respiration. At the end of your list, how many…
A: Redox reactions involve many reactions from cellular respiration, in which electrons are passed from…
Q: A newly synthesized protein contains a signal peptide on the N-terminus end of its polypeptide…
A: Proteins are a linear chain of amino acid sequences attached together via peptide bonds. There are…
Q: Intrinsic RNA chain termination is determined by specific sequences in the DNA called ____ sites.…
A: Termination during transcription occur via 2 methods. Intrinsic termination:- promote termination by…
Q: How do erythrocytes produce ATP? What is the role of ATP to red-cell morphology and function? 2. How…
A: Adenosine triphosphate (ATP) is an energy-carrying molecule particularly found in the cells of all…
Q: Which of the following statements is TRUE regarding the ABO blood system? People who have the…
A: There are 4 main blood groups A, B, AB and O and each of these groups can be either RhD positive or…
Q: I'm working on the thermodynamics of protein binding but I want to understand more on the enthalpic…
A: Introduction Protein folding and protein-ligand interaction are basically thermodynamically driven…
Which is true about eukaryotic cDNA? Choose all that apply
a. it is single stranded
b. it is made up of only introns
c. it is constructed from mRNA that is reverse transcribed
d.
Step by step
Solved in 2 steps
- Table 8.2: Transcription and translation of the first 7 codons in the B-globin chain of hemoglobin. Normal Sequence Mutated Sequence DNA DNA amino acid DNA DNA amino Codon MRNA Codon MRNA coding template strand coding template strand strand acid code code strand sequence sequence G 1 1 G G C 2 A 2 A 3 G G A A 4 4 C G A G G G G 7 A 7 A G G Shape of RBC Shape of RBC 23 3.In Figure 10-4, why is cDNA made only from mRNAand not also from tRNAs and ribosomal RNAsConvert the DNA template to mRNA. Then,convert the mRNA to tRNA. Based from theresulting sequence in the anticodons of tRNA,determine the appropriate Amino acid sequence that will be synthesized. Refer to the genetic code.1. DNA Template: TAC-GGC-TAC-CAT-ATG-GAGmrNa:tRNA:Amino acid sequence: 2. DNA Template: TTA-CAT-CAT-ATC-GAT-GACmrNA:tRNA:Amino acid sequence: 3. DNA Template: CTA-GCG- ATA - AAA-TTT-ATTmrNa:tRNA:Amino acid sequence:
- Which of these molecules has multiple partial charges and thus is most soluble in water? B H HHH HHH ABCD or E CH H CHOH D CH OH A cell is specialized in producing oil and steroid hormone. Which structure would be found in large r cell? O vacuoles O peroxisome O rough endoplasmic reticulum O smooth endoplasmic reticulum The oxygen released from photosynthesis results from: Reduction of NADP* to NADPH Chemiosmosis Oxidation of water Photophosphorylation3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…Below is a double stranded DNA that contains an ORF. Identify the ORF and in the spaces below, first provide the mRNA sequence that would result (in the 5' to 3' direction). Then give the protein sequence this mRNA would encode (in the N to C direction using the 3-letter abreviations and a single space in between). 5'-CTGCGC TAGGCGCAGTAGGGCATCCCACGACA-3' 3'-GACGCGATCCGCGTCATCCCG TAGGG TGC TGT-5' Codon Table: บบบ UUC JUA UUG CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val mRNA sequence: UCU UCC UCA UCG protein sequence: CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala UAU UAC UAA UAG CAU CAC CAA CAG Tyr Stop GAU GAC His Gin AAU Asn AAC AAAG} LUS Asp GAA GAG} Glu UGU Cys UGC UGA Stop UGG Trp CGU CGC CGA CGG AGU AGC Arg Ser AGG} Arg GGU GGC GGA GGG (DO NOT include the 5' and 3' numbers or the N and C. Write only the nucleotides and the abreviations for the amino acids. Include no spaces in the mRNA and a single space in between the amino acid…
- Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
- _______ are removed from new mRNAs. a. Introns c. Poly-A tails b. Exons d. Amino acidsThe following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Draw the primary transcript and the mRNA resulting from this DNA.Which of the following is/are typically removed from pre-mRNA during nuclear processing in eukaryotes? (a) upstream leader sequences (b) poly-A tail (c) introns (d) exons (e) all the preceding