Which diagram shows a system in which the lac operon genes are NOT going to be transcribed by the E. Coli? O Diagram B because the repressor protein is attached allowing for the RNA Polymerase to being to transcribe the genes. Diagram A because the repressor protein is no longer attached to the DNA segment. Diagram A because the repressor protein is ready to transcribe the genes Diagram B because there is no lactose present.

Which diagram shows a system in which the lac operon genes are NOT going to be transcribed by the E. Coli? O Diagram B because the repressor protein is attached allowing for the RNA Polymerase to being to transcribe the genes. Diagram A because the repressor protein is no longer attached to the DNA segment. Diagram A because the repressor protein is ready to transcribe the genes Diagram B because there is no lactose present.

Name: Which diagram shows a system in which the lac operon genes are NOT go
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Which diagram shows a system in which the lac operon genes are NOT going to betranscribed by the E. Coli?O Diagram B because the repressor protein is attached allowing for the RNAPolymerase to being to transcribe the genes.Diagram A because the repr

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 17P

See similar textbooks

Similar questions

Resection of a bacterial chromosome in which genes for the enzymes of of a particular metabolic pathway are clusteredtogether in a functional complex under coordinate control is called operon activator promotor repressor operator
The symbols a, b, and c in the table below represent theE. coli lac system genes for the repressor (I ), the operator(O) region, and the β-galactosidase (Z), although notnecessarily in that order. Furthermore, the order inwhich the symbols are written in the genotypes is notnecessarily the actual sequence in the lac operon.Activity (+) or inactivity (−) of Z geneGenotype Inducer absent Inducer presenta- b+ c+ + +a+ b+ c- + +a+ b- c- - a+ b- c+/a- b+ c- + +a+ b+ c+/a- b- c- - +a+ b+ c-/a- b- c+ - +a- b+ c+/a+ b- c- + +a. Which symbol (a, b, or c) represents each of the lacgenes I, O, and Z ?b. In the table, a superscript minus sign on a gene symbolmerely indicates a mutant, but some mutant behaviorsin this system are given special mutant designations.Using the conventional gene symbols for the lac operon,designate each genotype in the table.
pcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:
Alternative splicing Template strand S F yIGUide1,mq00:c-00: Replisome Transforming principle Origin of replication (or)eleb al msxS ain Coding strand Transcription factors Leading strand Single nucleotide polymorphism Okazaki fragment Telomerase M Nucleoside RNA Polymerase I RNA Polymerase II RNA Polymerase IIIon & of qu 9ven UoY Insertion mutagenesis Spliceosome Transcription Unit SNP Reverse transcriptase 1 Seminal work by Oswald Avery and colleagues demonstrated that DNA is what Frederick Griffiths called this etniog OS dotsM bioW 1-2kb of newly synthesized DNA strands are called this ainiog PS Assembly of the replisome is an orderly process that begins at these precise sites Snoiteeu 4 Transcribes ribosomal RNA genes in eukaryotes 5. A large nucleoprotein complex that coordinates activity at the replication fork Single base pair differences between homologous genomic regions isolated from different members of a population Complex of proteins and snRNAs catalyzing the removal of…
The following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′
5' 3' ORF1 ORF2 ORF3 ORF4 ORF5 1. Above are pictured 2 operons, one that includes ORF1 and OFR2 and is transcribed using the top DNA strand as the template, and the other includes ORF3, ORF4, and ORF5 and is transcribed using the bottom DNA strand as the template. 3' 5' a) Complete this diagram by using arrows (4) to indicate the position and direction of the promoter(s). It doesn't matter if you draw the arrows above or below the ORFS as long as they are pointing the right way. b) Underline and label with "RBS" the ribosome binding site(s). c) How many different RNA molecules will be made from this region of DNA? d) How many different proteins will be made from this region of DNA? e) How many promoters are found in this region of DNA? f) How many stop codons are found in this region of DNA? g) What assay would you use to investigate the protein accumulation of these ORFs?
Which area (A, B. C. or D) represents the region important for maintaining the gene of interest during binary fission? Arabinose operon Origin region ori Ndel arac Promoter Paan PGLO (5,400bp) Ndel Ampicillin Resistance Gene Amp Hindll Ndel Green Fluorescent Protein (GFP) Gene Hindll ECORI GraphicOE Schmid/2003 D O A OB OC OD
#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
In which strand is the promoter? 5' TCATGAGATA GCCATGCATA TCTAGTATGT AGGCATCTGA GTTTATATCT CA 3’ 3' AGTACTCTAT CGGTACGTAT AGATCTATCA TCCGTAGACT CAAATATAGA GT 5'
Cynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X G
Trp operon of E. coli is an inducible sytem since it turns on in the presence of tryptophan. In most bacteria, protein synthesis is initiated with a modified methionine residue (N-formylmethionine), whereas unmodified methionines initiate protein synthesis in eukaryotes. Both DNA replication and transcription follow a 5’ to 3’ direction of polarity. Write T if the statement is true and write F if the statement is false
40The accepted term for the functional investigation of a gene that starts with the gene sequence rather than a mutant phenotype is forward genetics. Yesorno 41Alu elements in the human genomes are examples of SINE elements. Yesorno 42The lac operon has three lac operators. Yesorno