What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence.
Q: If the nucleotide sequence of one strand of DNA is 5′ ACGTTGCA 3′, what is the sequence of the…
A: In molecular biology, the DNA is made of two complementary strands which runs antiparallel to each…
Q: Give the base sequence of the complementary DNA strand of the DNA chain with the following base…
A: DNA is a macromolecule composed of individual subunits known as nucleotides. Each nucleotide…
Q: What sequence of bases on one strand of DNA is complementary to the following sequence on another…
A: Complementary bade pairs It is the phenomenon where in DNA Guanine always hydrogen bonds to…
Q: Write the complementary DNA strand for the following DNA base sequence: 5' СТСААG 3' 3' 5'
A: Central dogma consists of replication, transcription and translation. Replication is the synthesis…
Q: If you are given the DNA sequence: T-A-C-G-G-T-C-A, determine the complimentary DNA strand.
A: DNA is the molecule which stores the genetic information in an organism that makes the nucleotide,…
Q: If the sequence of one strand of a DNA molecule is 5’-AGCCCCGACTCTATTC-3’, what is the sequence of…
A: DNA : Deoxyribonucleic acid is a double stranded molecule in which two strands are anti parallel and…
Q: The template strand of a double helical segment of DNA consists of the following sequence:…
A: INTRODUCTION: Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that…
Q: Which of the following combinations are true of the nucleotide composition of a sample of DNA?…
A: Deoxyribonucleic acid (DNA) is the chemical name for the molecule that carries the genetic…
Q: Give the DNA compliment to the following DNA strand. GTA SMH UUU GUA CAT
A: In DNA replication, the rule of complementarity is as follows- 1. Adenine (A) and Thymine (T) are…
Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…
A: DNA means deoxyribonucleic acid. DNA acts as the genetic material in most of the organisms present…
Q: If one DNA strand is 5′–GGCATTACACTAGGCCT–3′, what is the sequence of the complementary strand?
A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…
Q: If one DNA strand is 5′–GATTCGTTC–3′, what is the complementary strand?
A: Complementarity in the strands of DNA is referred to as a lock-and-key relationship between both the…
Q: What sequence of bases on one strand of DNA (reading in the 3′ to 5′ direction) is complementary to…
A: DNA (Deoxyribonucleic Acid) It is defined as a genetic material that has all the stored genetic…
Q: Given the following strand of DNA: 5' CATAGCCTTA 3' Which of the following sequences is the…
A: DNA and RNA are nucleic acids present in organisms. DNA is the deoxyribose nucleic acid whereas RNA…
Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…
A: Biomolecules are organic molecules made up of mainly carbon and hydrogen but there are other…
Q: What form of DNA corresponds to the Watson-Crick double helix structure? A form Z form…
A: DNA, the molecule carrying the genetic instructions in all living beings, is a polymer of…
Q: Give the complimentary DNA strand for the following: ACG TAG CTA GTC AGT CGT AGC Give the RNA…
A: NOTE:- Since you have posted a question with multiple sub-parts, we will solve the first three…
Q: Draw the following strands of DNA 5’ C-A-T 3’ as well as the complementary base pairing strand…
A: Two strands of DNA twist around one another to form a double helix DNA and both are in anti-parallel…
Q: A) Draw the structure and give the name of a nucleotide made of G + ribose. B) Write the…
A: Ribonucleic acid (RNA) is a polymer of ribonucleotides that participate in diverse biological roles…
Q: One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the…
A: The central dogma of molecular biology is the metabolic process in which the double-helical…
Q: Match the label on the left with the correct structure number in the DNA molecule in the image…
A: The given structure is of a alpha helix DNA. The DNA is composed of nucleotides. Nucleotide - The…
Q: If the sequence T-A-C-C-C-T appears on the informational strand of DNA, what sequence appears…
A: DNA is a deoxyribose sugar nucleic acid that carries genetic information from one generation to…
Q: One strand of a DNA helix has the sequence: 5'-ATTGCCGTC-3'. Write the sequence of its complementary…
A: A DNA helix is an antiparallel helix that is wound on each other. It consists of two complementary…
Q: Write the base sequence and label the 3' and 5' ends of the complementary strand for a segment of…
A: DNA is a duplex helical molecule, which has complementary base pairs. The complementary strands are…
Q: If this sequence of bases was on one side of a DNA moléčulé, whát wõuld be on the opposite side?…
A: The answer is TTTAGCC. The last option.
Q: Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA…
A: Double stranded nucleic acids are formed through hydrogen bonding between complementary nitrogenous…
Q: Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends:…
A: DNA is the molecule found inside cells that carries the genetic data required for an organism's…
Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the…
A: Deoxyribonucleic acid (DNA) is a molecule with two chains of polynucleotides that wrap around one…
Q: What is the name of the enzyme that add nucleotides to a growing DNA strand? What kind of bonds…
A: DNA strands are essentially polymers that comprise of deoxynucleoside monophosphate that are linked…
Q: If one strand of DNA has the sequence A-A-C-T-G-T-G, what will be the nucleotide sequence of the…
A: DNA replication is the process of formation of DNA without using its own template . This process…
Q: A strand of DNA contains the base pair 5’-T-C-A-G-C-A-T-3’. Give the base sequence on the…
A: Answer
Q: If the sequence of the 5'-3' strand is AATGCTAC, then the complementary sequence has the following…
A: DNA is the double stranded structure. Both strand is antiparallel to each other, direction of one…
Q: Which of the following statements are true about doublestranded DNA?a. A + C = T + Gb. A + G = C +…
A: DNA is formed of molecules known as nucleotides. Every nucleotide molecule is composed of a sugar…
Q: If a DNA strand has the nucleotide sequence of CCGAGATTG, what is the nucleotide sequence of the…
A:
Q: Which strand below would be the complementary strand for the sequence AAACGCTT O GGGTATCC O AAGCGTTT…
A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…
Q: Write the base sequence that would be sticky with the sequence T-A-T-G-A-C-T.
A: Erwin Chargaff discovered the complementary base pair rule. according to the chargeoff base-pairing…
Q: Using the codon chart, if the DNA strand being described is AGG TCT GAT , the resulting amino acid…
A: The order in which amino acids are found in a protein. Proteins are made up of 20 different types of…
Q: List the DNA bases that will complementary base pair with the following sequence: A-G-C-T-A-C-G
A: There are four nitrogenous base pairs in DNA Adenine Guanine Cytosine Thymine
Q: What is the term applied to the trinucleotide shown by the arrow? 5' AU Ру AGGCC G C G G G ACCACCUGe…
A: This a structure of tRNA, The tRNA molecule has a distinctive folded structure with three hairpin…
Q: Write the base sequence in a complementary DNA segment if each original segment has the following…
A: The cell is the basic primary unit of life for all living organisms. Inside this, the nucleus is the…
Q: he sequence of the DNA template strand is 3’– GACTTCC – 5’ What is the sequence of the DNA…
A: DNA (Deoxyribonucleic Acid) It is defined as a genetic material which has all the stored genetic…
Q: From the above sequence (DNA: ATGGATCCGCTTTAG), what is the amino acid sequence?
A: - Cells decrypt mRNAs by reading their nucleotides in teams of 3, known as codons. Here square…
Q: What is the complimentary DNA sequence to the strand below? C-G-G-T-T-A-G
A: Deoxyribonucleic acid (DNA) is a double-stranded molecule. DNA replication is the process by which…
Q: A strand of DNA runs the following direction with the following base sequence: 3'-AUG CCC CAG TTA -…
A: Complementary strands are two chains of DNA that make up the double-helical structure of DNA. The…
Q: Using the concept of complementary base pairing, write the complementary DNA strands, with their 5'…
A: The DNA molecule generally has two strands that wind around one another to form a shape is generally…
Q: If the sequence of base pairs on a DNA molecule are AGATTAGTG, what is the sequence on the…
A: Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that coil around each…
Q: If one strand of DNA has the sequence 5'-C-T-A-G-C-G-T-T-A-3', what sequence would appear opposite…
A: DNA is the genetic material that involves the transfer of information from one generation to the…
Q: If a region of one strand of a DNA double helix has the sequence 5'-CAGATAC-3', what is the sequence…
A: The nucleotide base pairing is complementary that is two complementary nitrogenous molecules are…
Q: Give the sequence of the complementary DNA strand of the DNA chain with the following base sequence:…
A: Deoxy ribonucleic acid is the double-stranded hereditary material that consists of sugar,…
Q: If I have a strand of DNA that has the base pairs as below, what would the base pairs be on the…
A: Adenine complements with thymine and cytosine complements with guanine in a DNA strand. According to…
What is the
Indicate the 5’ and 3’ ends. Follow the same format as the given sequence.
Learn your way
Includes step-by-step video
Step by step
Solved in 2 steps
- If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letterGiven the sequence shown below, write the complementary DNA sequence, using the base-pairing rules, as well as the directionality of the strands: 5'- CGAGGCTAGGTTAACCTG-3'One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment?
- For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strandWrite the base sequence and label the 3' and 5' ends of the complementary strand for a segment of DNA with the following base sequences: 5'CGGAC3'There is a chemically synthesized DNA oligonucleotide is 5’–AUCG–3’. Pleasedraw the all-atom structure of this RNA strand, including that of the phosphategroup, the pentose (ribose), and the base for each nucleotide. The structure is inthe 5’→3’ direction
- If I tell you that a stretch of DNA in the 5' to 3' direction is AGGTACGACCGT Give me the complimentary strand without and spaces, commas, symbols or anything else besides the nucleotide sequence (e.g. only: AAGCATCCGCTTA). Give me the complimentary sequence in the 3' to 5' orientation.If the sequence of one strand of a DNA molecule is 5’-AGCCCCGACTCTATTC-3’, what is the sequence of the complementary strand?Write the sequence of the complementary DNA strand that pairs with each of the following DNA base sequences:(a) TTAGCC(b) AGACAT
- In the DNA double-helix structure, the larger of the two grooves formed by the helical twist where certain base pairs are exposed is called the:Write the base sequence that would be sticky with the sequence T-A-T-G-A-C-T.What sequence of bases on one strand of DNA (reading in the 3′ to 5′ direction) is complementary to the sequence 5′ T-A-T-G-C-A-G 3′ on the other strand?