What is the mRNA coded by this template DNA strand? DNA Template Strand: 3' ATGGTACGGTCG 5' TACCATGCCAGC 5' O3' TACCATGCCAGC 5' AUGGUACGGUCG 3" UACCAUGCCAGC 3' O 3' UACCAUGCCAGC 5'
Q: If the parent diploid cell starts with 12 Chromosome and undergoes mitosis, then how many will the d...
A: Cell division is a process by which cells multiply themselves and it involves both cytoplasmic and n...
Q: Ureter are Tubes that carry urine from the kidneys to the bladder. Bladder is an organ holds the uri...
A: 1) Ureter : It is the tubular structure that extends from the kidney through the hilum (opening of ...
Q: 2. Corn is a flowering plant whose somatic chromosome number is 20. How many of each of the followin...
A: Introduction Mitosis is a nuclear division process that occurs in eukaryotic cells when a parent cel...
Q: What information provided by Jamie would lead the physician to suspect a systemic disease? Include a...
A: We are allowed to do upto three subpart of a question. Please repost the undone question again. Tha...
Q: QUESTION 3 Normal bony limitation of elbow flexion is limited by the coronoid process fitting into t...
A: Answer- Tuberosity of ulna
Q: А D
A:
Q: Expansins are activated by acidic conditions that modify the Select one: a. Hydrogen bonds between p...
A: Expansins are loosening proteins that function as loosening activity of plant cell walls.
Q: --TGT(G/C)CAG------3'
A: SNV means single nucleotide variants on individual RNA molecules To identify genomic differences we ...
Q: Aside from observing motility, what are the other uses of the wet mount and the hanging drop prepara...
A: Introduction: A wet mound slide is one that has a liquid in the centre that will act as a medium fo...
Q: Micronutrients play a critical role in assisting metabolic enzyme functions in our body? A. True B. ...
A: Enzymes are biocatalysts that are used to increase the rate of reaction and enzymes are not used up ...
Q: Differential gene expression describes how... (Choose the answer the best illustrates the definition...
A: The expression of genes in for transcription that is the production of RNA from DNA. After the RNA p...
Q: I learned that the base pairs for DNA are and and the base pair of RNA are and I learned that togeth...
A: Introduction:- Under normal circumstances, the nitrogen-containing bases adenine (A) and thymine (T)...
Q: Describe what happened if there is no biodiversit
A: Biodiversity: The biological variety and variability of life on Earth is referred to as biodiversit...
Q: CHARACTERISTICS EUKARYOTIC CELLS PROKARYOTIC CELLS Has a nuclear envelope DNA structure 2+ chromosom...
A: Prokaryotic DNA is double-stranded circular DNA that is dispersed in the nucleoid, a dense area of c...
Q: Which of the following statements about carbohydrates intake is TRUE? A. The whole grain bread has h...
A: The carbohydrates are found in a wide exhibit of both healthy and undesirable food varieties bread, ...
Q: Question 11 For the following statement, decide whether it is true or false and provide a justificat...
A: Plants take a great deal from the ground, namely water, fixed nitrogen (for proteins), phosphorous (...
Q: State the type of relationship shown between the black allele and the ginger allele for the gene giv...
A: Answer: Genetics is the study of genes and heredity, or how specific characteristics or traits are ...
Q: Base on your own opinion, what does genetics mean? What is its relationship to all living things? ...
A: Term genetics was given by William Bateson. Gregor Mendel is known as father of genetics. *Only fi...
Q: why does a high concentration of Abscisic acid (ABA) inhibit elongation of the coleoptile segments?
A: According to the question, we have to explain the reason behind the inhibition of elongation of cole...
Q: 3. If a gamete of a FISH-X has 32 chromosomes, how many of each of the following structures will be ...
A: “Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts f...
Q: Use the Punnett square below to answer the questions that follow. mH mh MH MMHH MmHh Mh MmHh Mmhh
A: 1. The punnett shows 2 alleles for 2 genes each hence first statement is True. 2. There are four dif...
Q: Every offspring is genetically identical with their parents
A:
Q: Identify (1) the protozoan in each image and structures (labeled a and b), (2) its mode of locomotio...
A: The protozoans of the kingdom Protista encompass a wide variety of unicellular creatures with differ...
Q: What's More Activity 2.1 Concept Map Directions: Fill in the concept map of the important events in ...
A: Introduction :- A woman's body undergoes a variety of changes each month between adolescence and men...
Q: A E
A: The human body's life process is maintained at multiple levels of structural organisation, from the ...
Q: Briefly, in your own words, describe the steps of the gram staining procedure.
A: The bacterial kingdom is classified into Gram positive and Gram negative bacteria depending on their...
Q: 3. If a gamete of a FISH-X has 32 chromosomes, how many of each of the following structures will be ...
A: There are two types of cell division : Mitosis Meiosis
Q: 7. You are preparing a library to sequence two samples, one from a WS and one from a FS, via Illumin...
A: Introduction Alignments are a important way to compare affiliated DNA or protein sequences. They c...
Q: Why some dominant mutant alleles are antimorphic
A: Mutations are modifications or alterations that occur in deoxyribonucleic acid (DNA). Mutagens are t...
Q: mtDNA is Select one: a. Double stranded linear DNA molecules b. Single stranded circular DNA molecul...
A: Introduction :- Mitochondrial DNA (mtDNA) has a number of unique characteristics, such as a high cop...
Q: What are common misunderstandings about evolution?
A: Introduction :- The process by which creatures evolve over time is known as evolution. Genetic varie...
Q: Steps of bone repair
A: The repairing of bones takes place in four stages: 1. Formation of blood clot 2. Bone production 3. ...
Q: 5. To figure out the initial concentration of a bacterial culture, you made an 8 fold dilution of th...
A: The bacterial culture is diluted 10 times. This species that 1ml of initial concentration is mixed ...
Q: Study the following scenario. Plot the 5-day menstrual dates in the calendar provided in the activit...
A: Let's assume first day of periods is 1 October (as you didn't mention in question). It's five day cy...
Q: In each of the following multiple-choice questions, characterize EACH of the three given statements ...
A: *In option 1 it is given that fats and oils have same general structure. * The oils and fats are cal...
Q: Question 8. How is the green fluorescent protein (GFP) attached to the protein for which it serves a...
A: The GEP can be described as a protein kind that can be naturally found in some living organisms such...
Q: Describe the role of GAP and GEF in activating GT passes
A: GAP: GTPase-activating proteins, also known as GTPase-accelerating proteins (GAPs), are a group of r...
Q: please help summary Results Labeling HIV-1 Capsids with a GFP Fluid Phase Marker. To determine w...
A: SUMMARY:- This study supports a model in which WT viral cores enter the nucleus and penetrate to an ...
Q: The FDA finds that chickens across the US are infected with a new type of bird-flu. They determine t...
A: The given code sequence is the mRNA and this undergo into translation process to form the amino acid...
Q: The value for the peak expiratory flow rate decrease in an individual with an upper respiratory trac...
A: Respiratory tract infection is caused by various pathogens and the common cold. There are also vario...
Q: c. chromatids at telophase II d. centromeres after telophase I e. centromeres after prophase II f. c...
A: Meiosis is the cell division process in which a diploid (2n) mother cell divides it's nucleus twice ...
Q: WHAT IF? Some membrane proteins diffuse faster in the plasma membrane when the cytoskeleton or the e...
A: Cell membranes: Thr diffusion across cell membranes uses integral membrane proteins to move polar o...
Q: Which protein did you make? Give its name and tell what it does.
A: Proteins are important macronutrients and is present throughout body ( bones , hair , skin , muscles...
Q: ow do normal cells get transformed into cancerous neoplastic cells? Elaborate giving three examples ...
A: Introduction :- A neoplasm, commonly known as a tumour, is an abnormal development of cells. Neoplas...
Q: A double-stranded molecule of DNA contains 120 cytosine (C) bases and 80 adenine (A) bases. How many...
A: DNA( Deoxyribonucleic acid ) is two stranded structure , which act as genetic material in most of t...
Q: 3. If a gamete of a FISH-X has 32 chromosomes, how many of each of the following structures will be ...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Wh...
Q: 3. Is it possible to create more than one dichotomous key for classifying and identifying the same g...
A: Dichotomous Key: A dichotomous key is an identification tool in which groups of organisms are repea...
Q: Discuss the different structures (primary, secondary, tertiary, and Quaternary structures) of protei...
A: The simplest level of protein structure is primary structure. It is simply the sequence of amino aci...
Q: Annual Mean Surlace Temperature of the Earth from 1880 to 2016 (in "C) Direct Measurements of Atmosp...
A: There is a linear relationship between rise in CO2 levels and mean surface temperatures of the earth...
Q: Pattern recognition receptors bind to Select one: a. B and T lymphocytes b. Host cell-associated mol...
A: Introduction Pattern Recognition Receptors are; Toll-like receptors (TLR) Nucleotide-binding oligom...
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation LeadpleThis is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.
- Given Sequence: 3’-TACGGTCCGGATTCGGTAGCTAGCATC-5’ Provide: Complementary Strand: Transcript Amino Acid Sequence 2.Given Sequence: 5’-GGGCATATGCCGTTTACCGGTTTGACTAAATAACCA-3’ Provide: Complementary Strand: Transcript Amino Acid Sequence 3.Given Sequence: 3’-AAC CAA TAC GTG AGG ATA CCA AGT AAC ACT CCC-5’ Provide: Complementary Strand: Direct Transcript: Transcript for Translation: Amino Acid Sequence:Transcribe an mRNA sequence from this TEMPLATE STRAND of DNA 3' CGTACGTGTATCCCATCC 5' 5' GCAUGCACAUAGGGUAGG 3' 5' GCAUGCACAUAGGGUAGG 3' 3' CGUACGUGUAUCCCAUCC 5' 5' GCATGCACATAGGGTAGG 3' 3' CGTACGUGTATCCCATCC 5'What is the DNA template for the RNA sequence 5' UAACGGAGCCUAAUC 3'? O 5' GAUUAGGCUCCGUUA 3' O 5' AUUGCCUCGGAUUAG 3' 5' GATTAGGCTCCGTTA 3' 5' TAACGGAGCCTAATC 3' O 5'ATTGCCTCGGATTAG 3'
- Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'What would the amino acid sequence be for the following DNA Transcript? 5’AAGCCATTTAAAGGC 3’ 3’ TTCGGTAAATTTCCG 5’ Phe Gly Lys Phe Pro Phe Leu Lys Phe Val Lys Phe Phe Lys Pro Lys Pro Phe Lys Gly More information is needed3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…
- 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence.I have a question I'm not sure about here it is...... If a short sequence of DNA is 5’-CGTAATCGGATC-3’, its complementary RNA strand is The answers given are: 5’- GCAUUAGCCUAG -3’. 5’- GAUCCGAUUACG - 3’. 5’-GATCCGATTACG - 3’. 5’-GCATTAGCCTAG - 3’.40 Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this code? 5' AAAGCATACCGG 3' Second letter G. UUU Phe UCU UAU) Tyr UGC Cys UGU UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUA UCA UUG Leu UG CAU His CGU CGC CGA CGG CU CUU CUC CUA CUG CAC Pro Leu Arg CCA CAA) Gin CCG CAG AAU AUU AUC lle AUA AUG Met ACG ACU AGU AAC Asn AGC Ser ACC ACA Thr AAA1 AGA AAG Lys AGG Arg GAU) Asp GGC GAC Ala GAA GGU GUU GUC GUA Val GCU GCC Gly GCA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a PRO-VAL-SER-PHE PHE-ARG-MET-ALA GLY-HIS THR-LYS d LYS-ALA-TYR-ARG First letter Third letter