What is the most likely consequence of a single base mismatch error made by RNA polymerase? A permanent change in the genome All of these answers are likely consequences O. An inability to recognize the transcription start site O An increase in gene expression levels An amino acid change in a protein
Q: ANSWER THE FOLLOWING PROBLEM AND EXPLAIN YOUR ANSWER FOR BETTER UNDERSTANDING. No. 3. Which Amino…
A: There are four classes of biological macromolecules; proteins, nucleic acid, lipids and…
Q: The full structure for the polypeptide found in wasp venom is shown. Identify the individual amino…
A:
Q: Which mutation will most likely cause the mutant or protein to misfold in terms of thermodynamics.…
A: Mutations are the permanent change in DNA sequence. These changes may occur naturally or by inducing…
Q: Monosaccharides can be classified based on the number of carbons they contain and the type of group…
A: The most basic type of carbohydrates are called monosaccharides, or "simple sugars." They are made…
Q: What are the main products of anaerobic glycolysis? Hoe does each one get metabolized?
A: Anaerobic glycolysis is defined as a metabolic process which takes place when oxygen is not present…
Q: 6 9 ation Which of the following is an unacceptable structure of a monosaccharide sugar? А. C. HOCH2…
A: Monosaccharides are the most simple sugars/carbohydrates. These are composed of carbon, hydrogen and…
Q: Estimate the number of amino acid residues in each of the two helices of a segment of the…
A: The structural configuration of alpha-keratin proteins, a class of fibrous structural protein…
Q: fertilizers
A: In various regions with distinct geographic characteristics, fertilizers containing zinc have been…
Q: 13. What is the main function of the carnitine shuttle system? a. To aid in the assembly of…
A: Carnitine shuttle system is a special mechanism that consists of two transport proteins called…
Q: The sugar molecule shown below is the cyclic form of a/an carbon is in the position. HO-CH2 O H H OH…
A: In the carbohydrate chemistry, the diastereomers differing only at the hemiacetal or acetal carbon…
Q: Many drugs are competitive inhibitors of specific enzymes. For drugs that act as competitive…
A: When a substrate (S) binds to the active site of an enzyme (E), it leads to the formation of an ES…
Q: Match the descriptions to the type of G protein. Heterotrimeric G proteins monomeric in both active…
A: G proteins (Guanosine nucleotide-binding proteins) can be broadly classified into two types. They…
Q: What kind of catalysis is cysteine driving in this picture? H-N. Metal catalysis Covalent catalysis…
A: General Acid/Base Catalysis: Catalysis involves proton transfer from weak acid or to weak base other…
Q: You run a series of assays at 25°C on enzyme A. You measure the velocity for a range of S…
A: This question can be solved using Lineweaver Burk plot. This graph also represents the enzyme…
Q: 15. Write the metabolites of the following substrates due to phase Il reactions: a. b, R 20 R C. R R…
A: Enzymes are proteins that catalyze biochemical reactions. Enzymes sometimes require a non-protein…
Q: G protein-coupled receptors (GPCRs) and receptor tyrosine kinases (RTKs) are two basic receptor…
A: GPCR stands for G Protein-Coupled Receptor a type of cell surface receptor involved in signaling.RTK…
Q: 3. Fates of pyruvate. Pyruvate has several metabolic fates (some of which you'll learn later) but in…
A: Pyruvate is an important product of glycolysis. It can also be defined as an important junction…
Q: Which of the following lipids would you expect to find as a structural component in a membrane, and…
A: Phospholipids are a class of lipids that are essential components of cell membranes in all living…
Q: How many ATP, NADH, and FADH are formed in the krebs cycle?
A: Cellular respiration can be defined simply as a series of metabolic processes that take place within…
Q: Choose Two. The Ramachandran plot indicates: B Ca E ||||||| C1 H H A Combined preference for a about…
A: Amino acids are the building blocks of protein. There are 20 standard naturally occuring amino acids…
Q: Of the allosteric enzymes listed below, which are suppressed by NADH? Select all that apply. the…
A: Enzymes catalyse biochemical reactions. Substrate binds to the enzyme's active site and is converted…
Q: An alpha-helix transmembrane protein has 35 amino acid residues embedded in a lipid bilayer…
A: The repeating unit of an alpha-helix is the helix turn. Each helical turn in alpha-helix has an…
Q: ration Determine how reaction rate (velocity) varies with substrate concentration. Rate increases…
A: Q.Explanation:- Substrate is a specific term for the reactant on which a particular type of enzyme…
Q: Finish the sentence alpha helical secondary structures in proteins Are connected by peta- turns Are…
A: Secondary structure is the ordered arrangement or conformation of amino acids in localized regions…
Q: One way of expressing the rate at which an enzyme can catalyze a reaction is to state its turnover…
A: Kcat, or turnover number is the number of substrate molecules converted to product at one active…
Q: Which amino acid residue is most likely to be found in position "a" or "d" of the pseudo repeat in?…
A: Proteins are the important biomolecules synthesized in biological cells as final products of gene…
Q: Briefly describe the difference between a reversible and irreversible reaction in a metabolic…
A: A metabolic pathway is a sequential series of linked biochemical reactions that convert a starting…
Q: How many co2 are produced from 1 glucose and 1 c16 fatty acid?
A: During the process of cellular respiration, one glucose molecule breaks down into six carbon dioxide…
Q: Which of the following are ligands bound to the porphyrin ring Fe(II) ion in oxymyoglobin? His E7…
A: In oxymyoglobin (a heme-containing protein), the porphyrin ring surrounds the iron (Fe) ion, and…
Q: In the article the authors reference the canonical forces in protein folding. Describe how these…
A: As per the central dogma of molecular biology, the DNA contain the information needed to synthesize…
Q: Proteins are made from chains of amino acids. The amino acids are joined together by structures…
A: Dipeptide
Q: Use Excel to make the data plot and include the graph in your submission. For all questions…
A: Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: Which of the following would not increase efficiency of transfer of oxygen from hemoglobin to…
A: Haemoglobin is a transport protein that helps in carrying of respiratory gases like oxygen and…
Q: 1) Phosphatidate composed of octadecanoate fatty acids 2) Phosphatidate composed of hexadecanoate…
A: The graph given below shows the fluidity of membrane. The degree of bilayer fluidity depends on…
Q: Which pairs of amino acid side chains might you expect to find in a salt bridge in a protein at pH…
A: Amino acids are the monomer units that adjoin via peptide linkages to form proteins. There are 20…
Q: Assume a protein is composed of 120 amino acid residues and that each amino acid can have three…
A: A protein's biological function depends on its three-dimensional structure. The 3D structure is…
Q: You fill a (fixed volume) dialysis bag with a solution of a protein (1 mM) in water, seal the…
A: Dialysis tubing can be defined as a semi permeable membrane tubing is particularly used in…
Q: The sigmoidal, cooperative binding curve commonly observed for hemoglobin is a result of: a)…
A: Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: ... 3: Ascorbic acid (shown below) has two chiral centres, which have been labelled. Assign the…
A: Configuration is the spatial arrangement of atoms or groups around a chiral center. A chiral center…
Q: Give the Steps, Enzyme/s involved, Electron carriers, ATP Generation, End product and significance…
A: Aerobic respiration is a collection of three metabolic pathways that generate ATP by the oxidation…
Q: most amount of attraction to an anion column operating at the physiological ph
A: pH (Potential of Hydrogen):It is a measure of the acidity or alkalinity of a solution.It quantifies…
Q: The F₁F. - ATP synthase is a molecular machine that converts the proton motive force into enzymatic…
A: The molecular device known as F1F0-ATP synthase transforms the proton motive force into enzymatic…
Q: Why might the compound below be a potent transition state analog inhibitor for isocitrate…
A: Transition states are short-lived species that arise as a substrate is being converted to a product…
Q: What metabolic pathways are aerobic and which are anaerobic? What are the advantages and…
A: A living organism's total chemical reactions are referred to as its metabolism. It incorporates…
Q: Membrane lipids in tissue
A: Membrane lipids:These are an important component of cell membranes.These surround and enclose cells…
Q: What do most amino acids have in common with most monosaccharides? O Both contain ionizable groups…
A: Amino acids are the building blocks of proteins. There are 20 major proteogenic amino acids that…
Q: Match the structures below with the type or name of the structure. Each match should be used only…
A: Triglycerides are esters, made up of a glycerol molecule bound to three fatty acid moleculesFatty…
Q: What sugar is formed upon hydrolysis of starch and cellulose?
A: The question is asking about the type of sugar that is formed when starch and cellulose undergo…
Q: Uridine monophosphate (UMP) undergoes a deuterium exchange in deuterated water as shown below.…
A: As we know, water is made up of two hydrogen atoms covalently bonded to single oxygen atom. Hydrogen…
Q: The Michaelis-Menten equation is often used to describe the kinetic characteristics of an…
A: Vmax is defined as the maximum reaction velocity at which all enzymes become saturated with…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Define and compare the following types of nucleotide substitutions. Which is likely to cause the most dramatic mutant effect? a. missense mutation b. nonsense mutation c. sense mutationIf the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. Fluxome
- How is the final rate of transcriptionof a gene specified by the hundreds ofproteins that assemble on its controlregions? Will we ever be able to predictthis rate from inspection of the DNAsequences of control regions?The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairingAn investigator was interested in studying UAG nonsense suppressor mutations in bacteria. In one speciesof bacteria, she was able to select two different mutants of this type, one in a tRNATyr gene and the otherin a tRNAGln gene, but in a second species, she wasnot able to obtain any such nonsense suppressor mutations, even after very extensive effort. What couldexplain the difference between the two species?
- The amino acid sequence of part of a protein has beendetermined:N . . . Gly Ala Pro Arg Lys . . . CA mutation has been induced in the gene encodingthis protein using the mutagen proflavin. The resultingutant protein can be purified and its amino acidsequence determined. The amino acid sequence of themutant protein is exactly the same as the amino acidsequence of the wild-type protein from the N terminus of the protein to the glycine in the preceding sequence. Starting with this glycine, the sequence ofamino acids is changed to the following:N . . . Gly His Gln Gly Lys . . . CUsing the amino acid sequences, one can determinethe sequence of 14 nucleotides from the wild-typegene encoding this protein. What is this sequence?Suppose you are a research assistant ina lab studying DNA-binding proteins. You have been giventhe amino acid sequences of all the proteins encoded bythe genome of a certain species and have been asked to findcandidate proteins that could bind DNA. What type of aminoacids would you expect to see in the DNA-binding regions ofsuch proteins? Explain your thinking.The following is a list of mutations that have beendiscovered in a gene that has more than 60 exons andencodes a very large protein of 2532 amino acids.Indicate whether or not each mutation could cause adetectable change in the size or the amount of mRNAand/or a detectable change in the size or the amountof the protein product. (Detectable changes in size oramount must be greater than 1% of normal values.)What kind of change would you predict?a. Lys576Val (changes amino acid 576 from lysineinto valine)b. Lys576Argc. AAG576AAA (changes codon 576 from AAG toAAA)d. AAG576UAGe. Met1Arg (at least two possible scenarios exist forthis mutation)f. promoter mutationg. one base pair insertion into codon 1841h. deletion of codon 779i. IVS18DS, G–A, + 1 (this mutation changes thefirst nucleotide in the eighteenth intron of the gene,causing exon 18 to be spliced to exon 20, thusskipping exon 19)j. deletion of the poly-A addition sitek. G-to-A substitution in the 5′ UTRl. insertion of 1000 base…
- The method of Northern blotting is used to determine the amountand size of a particular RNA transcribed in a given cell type.Alternative splicing (discussed in Chapter 14) produces mRNAsof different lengths from the same gene. The Northern blot shownhere was obtained using a DNA probe that is complementary tothe mRNA encoded by a particular gene. The mRNA in lanes 1through 4 was isolated from different cell types, and equal amountsof total cellular mRNA were added to each lane. Explain these results.When 1 million cells of a culture of haploid yeastcarrying a met− auxotrophic mutation were plated onpetri plates lacking methionine (Met), five coloniesgrew. You would expect cells in which the originalmet− mutation was reversed (by a base change back tothe original sequence) would grow on the media lackingmethionine, but some of these apparent reversions couldbe due to a mutation in a different gene that somehowsuppresses the original met− mutations. How wouldyou be able to determine if the mutations in your fivecolonies were due either to a precise reversion of theoriginal met− mutation or to the generation of a suppressor mutation in a gene on another chromosome?Genes participating in informational processessuch as replication, transcription, and translation aretransferred between species much less often than aregenes involved in metabolism. The basis for this inequalityis unclear at present, but one suggestion is that it relatesto the underlying complexity of the two types of processes.Informational processes tend to involve large aggregatesof different gene products, whereas metabolic reactionsare usually catalyzed by enzymes composed of a singleprotein. Why would the complexity of the underlying pro-cess—informational or metabolic—have any effect on therate of horizontal gene transfer?