What is the effect of the insertion of a nucleotide in the 4th codon of the DNA sequence below? (Hint: write out and translate the original mRNA underneath the template DNA. Then, insert a nucleotide into the 4th codon and retranslate the sequence.) Template: 3'-TAC AAA CTA GTG AAT AGA TTT CCA CGT ACT GGG-5"

What is the effect of the insertion of a nucleotide in the 4th codon of the DNA sequence below? (Hint: write out and translate the original mRNA underneath the template DNA. Then, insert a nucleotide into the 4th codon and retranslate the sequence.) Template: 3'-TAC AAA CTA GTG AAT AGA TTT CCA CGT ACT GGG-5"

Name: What is the effect of the insertion of a nucleotide in the 4th codon
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: What is the effect of the insertion of a nucleotide in the 4th codon of the DNA sequence below?(Hint: write out and translate the original MRNA underneath the template DNA. Then, insert anucleotide into the 4" codon and retranslate the sequence.)Tem

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 16SA

See similar textbooks

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Use a codon chart determine the amino acid sequence. Remember to read through the strand and ONLY start after the promoter and STOP when it tells you to stop. Follow example below: Example: DNA AGA TATA TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA O protein AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG start-glu-ala-thre-hist - asp-glu-threo-stop met DNA CCT ATA TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC mRNA DGGA UAU) AUG uGul Gcc nccl cAul GCol protein ly Tur MeT cys AlA ser HIJ Ala 2 3 4 DNA AGA ACT ATA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA protein DNA TAT ATAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC mRNA protein D DNA TAA ACT ATA TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA protein Auu UGA UAU AGU GAUCGA AUC MAG Auu AAU leu Stop. TRY-Met-Asp- ARG-Isle-Stop-Ile. Asn DNA CTA TTT ATA TAC TAG AGC GAA TAG AAA CTT ATC ATC mRNA protein D DNA CAT ATA TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG…
CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT TAG TCG ATT ACC CGT TTA TGT TAA TTA CCT ATC 2. Figure out the tRNA triplet (codons) that would fit the mRNA triplets. (letter by letter)
Given the following stretch of mRNA, what would be the sequence of the corresponding non-template DNA? 5' - UUG-CAA-UCG-CAG-UGC-CGC-AUA-GAU - 3' Group of answer choices 3' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 5' 5' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 3' 5' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 3' 3' - AAC-GUU-AGC-GUC-ACG-GCG-UAU-CUA - 5' 3' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 5'
Table 8.2: Transcription and translation of the first 7 codons in the B-globin chain of hemoglobin. Normal Sequence Mutated Sequence DNA DNA amino acid DNA DNA amino Codon MRNA Codon MRNA coding template strand coding template strand strand acid code code strand sequence sequence G 1 1 G G C 2 A 2 A 3 G G A A 4 4 C G A G G G G 7 A 7 A G G Shape of RBC Shape of RBC 23 3.
CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT TAG TCG ATT ACC CGT TTA TGT TAA TTA CCT ATC 1. Build the mRNA molecule matching the RNA nucleotides to the DNA nucleotides properly letter by letter. (assume that the mRNA is bacterial there are not intros to cut out) 2. Figure out the tRNA triplet (codons) that would fit the mRNA triplets. (letter by letter) 3. Look up for each tRNA codon and find the corresponding symbol and amino acid abbreviations. The symbols should spell out a meaningful English message.
Fill in the blanks (NO PARAGRAPHS ONLY SHORT ANSWERS) Normal DNA: TGC GTG CTT AAG CGG TGT ACA CGT TGC mRNA: Animo Acid: 1st Mutation TGC GTG CTT AAG CGA TGT ACA CGT TGC mRNA: Animo Acid: Do you think it will affect the protein’s function? Why? 2nd Mutation TGC GTG CTT AAG CGG TGT GCA CGT TGC mRNA: Animo Acid: What kind of mutation is this? Do you think it will affect the protein’s function? Why?
CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT TAG TCG ATT ACC CGT TTA TGT TAA TTA CCT ATC 1. Build the mRNA molecule matching the RNA nucleotides to the DNA nucleotides properly letter by letter. (assume that the mRNA is bacterial there are not intros to cut out)
What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'
Transcribe the corresponding mRNA strand from the given DNA strand: DNA: TAC GCA CCC AGC CTA TCC GTC ATT mRNA: Complete the corresponding DNA strand from the mRNA strand: DNA: mRNA: AUG ACU GCG CCC CGA UCC UGU UAA Translate the following mRNA sequence into its appropriate amino acid sequence: (abbreviate amino acids by first three letters. Example: Methionine abbreviates to MET mRNA: AUG CUU AGC ACU GUU GAU UAU UCG Given the amino acid sequence, complete a possible DNA strand that compliments the strand: DNA: mRNA: Amino Acids: Met – Lys – Pro – Arg – Ser – Leu - STOP
Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG