Q: Discuss "The respiratory pathway is an amphibolic pathway."
A: An amphibolic pathway basically refers to the pathway which incorporates both anabolic and catabolic…
Q: Why is it necessary to study the diffusion of molecules in biological systems? To understand…
A: Diffusion is important to cells because it allows them to gain the useful substances they require to…
Q: How many links long are MOST food chains? O 2 links or fewer O 5 links or fewer 8 links for fewer O…
A: Introduction A food chain is a feeding relationship between different organisms in a particular…
Q: Questions 17-20 A student uses restriction enzymes to cut a DNA molecule into fragments. The…
A: 17.Correct option is (D) number of nucleotides in the fragment The following factors influence the…
Q: 4.What is the fate of the fertilized ovule of a flower? Read and analyze the question and choices…
A: Flower is most conspicuous , fascinating, fragranted part of plant and is major characteristic of…
Q: If living cells were produced in a test tube from nonbiological components by chemical processes,…
A: The first cells that appeared on the earth are believed to be prokaryotic heterotrophic and are…
Q: What is meant by 'B lymphocytes are sensitive to clonal deletion'?
A: Immunity
Q: how does the sequence of the primary transcript resemble the sequence of the gene encoding it
A: The genes undergo transcription to form mRNA. The mRNA is then modified via post-transcriptional…
Q: The cardiac cycle includes all the events associated with the flow of blood through the heart during…
A: Heart- a organ in most of the animals that pumps blood through the blood vessels of the…
Q: Understanding geologic time is significant because it helps us a. Understand humans’ impact on our…
A: The evolution of different organisms occurs in different time periods on the earth. The primitive…
Q: Marisol has an Earth Overshoot Day of April 11th. Ali's Earth Overshoot Day is July 5th. Esperanza's…
A: Earth overshoot day is a day dedicated to one day of the year where the usage of natural resources…
Q: Multi-step tumor progression helps to explain familial polyposis.
A: *Familial adenomatous polyposis is an Autosomal dominant inherited condition in which adenomatous…
Q: The figure below is redrawn from a study that tracked over one hundred HIV-infected individuals for…
A: Pathogenicity refers to the ability of a psthogen to csuse disease, and virulence signifies the…
Q: 26. In sheep, eye color is controlled by a single gene with two alleles. When a homozygous…
A: *NOTE: Kindly repost for other questions. Dear Student as per the guidelines we are supposed to…
Q: What is the correct order of appearance in the fossil record, starting with the earliest: flowering…
A: Fossils are the remains of living organisms that was found after the organism was buried properly.…
Q: What percent of the energy stored at one trophic level is stored at the next trophic level?
A: As the pyramid of energy is always upright which shows that at 100% transfer of energy is not…
Q: 1. Recombinant DNA technology products are now used in various fields, some in agriculture, while…
A: Recombinant DNA technology It refers to the combining of DNA molecules from two distinct species.…
Q: Give the different classes of each phylum. 1. Phylum Cnidaria 2. Phylum Mollusca 3. Phylum…
A: Cnidaria Radial symmetry, tissue level of organisation, acoelomate animals. Classification: On the…
Q: Explain the answer using the concepts of protein inside the microorganisms cell wall etc
A: Disinfection is a process in which the micro organisms are reduced through the disinfectants on…
Q: Define RQ. What is its value for fats?
A: RQ stands for respiratory Quotient. It is the volume of carbon dioxide liberated over the volume of…
Q: 19.As observed in animal stem cells, plant meristems are able to? Read and analyze the question and…
A: Stem cells These cell are special cell that have potential to develop into any kind of cell or…
Q: How can drug resistance in microorganisms be circumvented?
A: Antibiotic resistance is becoming a threat to the world now a days. This is because, if microbes…
Q: Widow’s Peak is dominant over straight hairline. Free earlobes are dominant over-attached. A…
A: Given Widow’s Peak = dominant Straight hair = recessive Free earlobe = dominant Attached earlobe…
Q: Multi-step tumor progression helps to explain familial polyposis
A: Answer :- According to given statement that Multi-step tumor progression helps to explain familial…
Q: explain properly. How is a species’ population dynamics affected by the presence of another species…
A: A species ecological niche can be defined as the range of resources and the conditions allowing the…
Q: importance of plasma proteins
A: Plasma proteins These are blood proteins or the proteins present in the bloodstream. They are of…
Q: How do prey populations "mold" predator populations? Support your answer with evidence from your…
A: The interactions between populations of species in a community are broadly categorised into positive…
Q: 5. COVID-19 is caused by: 1. SARS-COV 1 2. SARS-COV 2 6. A disease that infects humans but…
A: COVID -19 is mainly caused by virus that became pandemic now a days.
Q: Evidence exists that a catastrophic collision between Earth and a large extraterrestrial body…
A: Mass extinction is the extinction of a large number of species over a short duration of time due to…
Q: What is the importance of plasma proteins?
A: Plasma proteins are a group of proteins that circulate in the blood and play an important role in…
Q: How do vaccines help your immune system against the covid-19 virus?
A: Vaccines help our immune system against covid-19 virus.
Q: .Who among these evolutionary thinkers stated that the living forms come from the seas? a. Erasmus…
A: Introduction Evolution:- It is simply the biological change of a species over a span of time or the…
Q: brown-eyed sheep is crossed with a homozygous green-eyed sheep, blue-eyed offspring are produced. If…
A: DISCLAIMER As per the guidelines, as you have asked multiple questions, we will solve the first…
Q: Explain why cells need to receive nutrients (explain what nutrients are and give examples).
A:
Q: how would you convince a person about the validity of evolution in biogeography?
A: Biogeography can be utilized to show that life forms that live in similar conditions will generally…
Q: Rehabilitation robotics, to use robots as therapy aids instead of solely as Smart rehabilitation…
A: The question has asked about a short explanation of the main terms provided in the question which…
Q: Name at least five different deficiency symptoms in plants. Describe them and correlate them with…
A: The five most common deficiency symptoms that appear in plants are as follows: Chlorosis Necrosis…
Q: 1. How often should treatment with azathioprine be monitored with liver enzymes and a full blood…
A: Azathioprine
Q: 6.Which term refers to the waxy or fatty layer of most epidermal cells that forms a protective layer…
A: Epidermis is the outer covering layer of the cells that forms the covering of the root, stem, leaf,…
Q: Posterior 5. Dorsal 6. Ventral
A: The standard body “map,” or anatomical position, is that of the body standing upright, with the feet…
Q: What are the assumptions made during the calculation of net gain of ATP?
A: Several assumptions are made in order to perform theoretical calculations on ATP molecules, the most…
Q: Related species of terrestrial animals typically display allometricrelations between body-water…
A: In the system of the well-known term which is used to define the broadest sense, allometry describes…
Q: In humans color vision is X-linked, the gene for color vision is located on the X chromosome but is…
A: Colour blindness is a X linked Recessive disorder in which presence of gene n on X chromosome is…
Q: How did Charles Lyell & James Hutton's theory of evolution differ from that of George Cuvier?
A: Charles lyell and James huttons together proposed the concept of uniformitarianism . According to…
Q: RuBisCo is an enzyme that acts both as a carboxylase and oxygenase. Why do you think RuBisCo carries…
A: Introduction In this question we will discuss whether the RuBisCo carries out more carboxylation in…
Q: 3. a. In the process of converting ADP to ATP, water is circle one: (REQUIRED / RELEASED) and…
A: Cellular respiration is a metabolic process which involves degradation of glucose and Liberation of…
Q: Which test is performed to evaluate bleeding disorders?
A: Bleeding disorders are a range of illnesses in which the body's blood coagulation mechanism fails.…
Q: Sino-atrial node is called the pacemaker of our heart. Why?
A: Introduction In this question we will discuss why Sino-atrial node is called the pacemaker of our…
Q: Why are food chains relatively short? O Not enough energy is transferred from one trophic level to…
A: A food chain can be defined as the relationship between constituents of one trophic level and…
Q: In human’s farsightedness is inherited by possession of a dominant allele A. If a man who is…
A: ANSWER;-
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
What is the Central Dogma of biology?
•. Name FOUR
nOW.
‡. DRAW the new DNA codon for your NEW
amino acid (5'-3")
g
DRAW the new mRNA codon for your
new amino acid (5'-3°).
Step by step
Solved in 2 steps
- DNA Transcription (RNA Synthesis) DNA A Transcription MRNA | Codone 4. Look at the picture above. What do you notice about RNA's nucleotides (base pairs) compared to DNA nucleotides? 5. Finish transcribing DNA to mRNA *Remember (U) Uracil replaces (T) Thymine in RNA molecule* DNA GAT TTA AAC CGT TCA GGT AAG CAA MRNA CỦA AAU3. Analyzing the Molecules of Life - Molecular Diagnostics An mRNA that encodes a variant of a human protein is as follows (the mutation is highlighted in red): CUUGUUAACAACUAAACGAACAAUCUUUGUUUUUCUUGUUUUAUUGCCACUAGUCUCUAG UCAGUGUGUUAAUCUUACAACCAGAACUCAAUUACCCCCUGCAUACACUAAUUCUUUCAC ACGUGGUGUUUAUUACCCUGACAAAGUUUUCAGAUCCUCAGUUUUACAUUCAACUCAGGA CUUGUUCUUACCUUUCUUUUCCAAUGUUACUUGGUUCCAUGCUAUACAUGUCUCUGGUAA RT-qPCR can be used to detect the variant (mutation). (a) In a few sentences or using a simple diagram/flowchart, describe the basic principle of RT-qPCR, and show the sequence of a DNA primer that can be used to reverse transcribe the entire RNA molecule as shown at 37 °C. (b) Design a pair of primers (DNA oligonucleotides) for detecting the mutation by qPCR. Assume that the PCR reaction will be performed at 72 °C. Show the sequences of your primers and their estimated Tm.10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence an
- 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence.The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this? complementarity nonsense codons universality degeneracyA particular DNA coding segment is ACGTTAGCCCCAGCT • Write the sequence of nucleotides in the corresponding mRNA. • Determine the amino acid sequence formed from the mRNA during translation. • What amino acid sequence results from each of the following mutations? a. replacement of the underlined guanine by adenine b. insertion of thymine immediately after the underlined guanine c. deletion of the underlined guanine
- Exercise In this exercise we will practice transcribing and translating sample DNA. Using your sample DNA, unzipped and second strand removed, you will first create an RNA strand (transcription). DNA is read in the 5' → 3' direction, so when you create RNA, a 3'end pairs with the 5' end of DNA. From your RNA strand, you will need to create codons; remember that a codon is a group of 3 bases that codes for a specific amino acid. Your codons are read in the 5' → 3' direction (hint: it might be right to left!). You will then need to convert your codons into amino acids in the 5' → 3' direction (translation). DNA strand 3' TAC-TTA-CGA-TGG-TAC-ACG-CAA-TCT-ATA-CTC-AAA-TAT-AGG-ACC-TTG-ACG-TCG-AAT-CTC-CAC-TGT-ACC-TTG-AAC-CTG-ACT 5' RNA strand 5'-AUG-AAU Amino acid sequence G ne (9)try w1 II. In each of the following DNA sequences, write on your answer sheet the corresponding mRNAtranscript and use the genetic code to determine the resulting amino acid sequence. Note that the givenstrands are in the 3’ to 5’ direction. Start the amino acid sequence with the start codon and end withstop codon.1. TTTTACCATCCCACAATTTA mRNA: _________________________ Amino acids: _____________________ 2. ACTACTTTCAGAGCTATATTCAG mRNA: _________________________ Amino acids: _____________________Remember when looking up a codon make sure it is in its mRNA form. Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 2.What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this? Often this type of mutation does show symptoms until middle age. What problem does this create? 3.What are three differences between a point mutation and deletion mutation
- 1. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.) 2. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.)Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence. 5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’ Make the following mutation in this sequence by changing/adding/removing only one nucleotide. Make the mutation easy to see (a different color, circled, something like that) A frameshift mutationUse this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence. 5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’ Make the following mutation in this sequence by changing/adding/removing only one nucleotide. Make the mutation easy to see (a different color, circled, something like that) A missense mutation that is also a transversion