What happens when EF-Tu is mutated? Choose from the options below. Be involved in transcription instead of translation Peptide bond formation is inhibited Incoming tRNA will not be able to enter through the A site Incoming tRNA will not be able to enter through the P site Incoming tRNA will not be able to enter through the E site Translocation is inhibited Hairpin loop formation

What happens when EF-Tu is mutated? Choose from the options below. Be involved in transcription instead of translation Peptide bond formation is inhibited Incoming tRNA will not be able to enter through the A site Incoming tRNA will not be able to enter through the P site Incoming tRNA will not be able to enter through the E site Translocation is inhibited Hairpin loop formation

Name: What happens when EF-Tu is mutated? Choose from the options below.Be i
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: What happens when EF-Tu is mutated? Choose from the options below.Be involved in transcription instead of translation Peptide bond formation is inhibited Incoming tRNA will not be able to enter through the A siteIncoming tRNA will not be able to ente

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

How does the antibiotic streptomycin inhibit bacterial translation? Multiple Choice blocks elongation by preventing the large ribosomal subunit from binding to the small ribosomal subunit interferes with the normal pairing of aminoacyl TRNAS and codons resulting in abnormal proteins prevents the release of the initiator tRNA from the P site, blocking elongation blocks termination by competitively inhibiting the binding of a release factor to the A site
What happens if you replace the trp codons in the trp leader sequence with codons specifying Isoleucine? The cell will synthesize tryptophan when it is low on isoleucine The cell can't synthesize tryptophan at all The cell will synthesize Isoleucine when it is low on tryptophan O The cell will synthesize tryptophan when it is low on tryptophan
TRNAS are 'charged' or activated by aminoacyl TRNA synthetases. Select the correct statements regarding this process. The process is dependent on interactions between ribosomes and aminoacyl TRNA synthetases. The aminoacid is added to the D-loop of the tRNA. Aminoacyl TRNA synthetases are pre-associated with tRNAS. The amino acid is attached to the terminal to the 3' hydroxyl of an adenine in the acceptor arm. The process requires an aminoacyl-adenylate intermadiate. QUESTION 19 Select the correct statements regarding myosin-mediated contraction the sarcomere. O Ca2+ is required for the binding of myosin to f-actin. Myosin and f-actin are randomly distributed in the sarcomere. Physical pulling of the actin microfilament requires three distinct conformation changes on myosin that involve ATP binding, ATP hydrolysis and sequential release of inorganic phosphate and ADP. Myosin-mediated contracted is ubiquitous across all cell types. O O O O
E channel Charged tRNA Anticodon for START Initiating factors Release factors m III III exit site for an uncharged stem of tRNA UAC located on tRNA's anticodon arm proteins that help mRNA bind to a small and large ribosomal subunit to start translation a tRNA that contains its appropriate amino acid attached to the acceptor arm bind to STOP codons and result in a hydrolysis reaction that creates a drop of water that halts translation
Using the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -Termination
Which of the following is not true? There are two major classes of aminoacyl-tRNA synthetases The selectivity of the aminoacyl-tRNA synthetases for their tRNA molecules is often called the second genetic code A single activating enzyme can interact with all the tRNAs for its corresponding amino acid aminoacyl-tRNA synthetases link amino acids to tRNA molecules without the need for an energy source
Which of the following characterize RNA polymerase Il transcriptional termination in eukaryotes? Endonuclease cleavage of the RNA transcript and 5' to 3' exonuclease activity a protein known as Ratl None of the provided answers, transcriptional termination occurs in prokaryotes. Recognition of the transcriptional stop codon by a release factor. Hairpin structure formation on the newly synthesized RNA molecule which disrupts the DNA-RNA hybrid at a poly-U RNA sequence Binding of the Rho protein.
EF-tu binds to the 3'end of charged tRNAs can only bind a charged tRNA when it is associated with a GTP delivers the charged tRNA to the A site of the ribosome. all the above
The figure depicts what kind of splicing: A sequence change (asterisk) has abolished the acceptor site at the 3' end of intron 1. Exon 2 is skipped A sequence change has abolished the acceptor site at the normal end of intron 2. Instead of skipping exon 3, the spliceosome has found a nearby alternative acceptor-like sequence, a' in intron 2, to use. the three exons are spliced as processed normally A sequence change has activated a cryptic acceptor site, a’ in intron 2. A downstream sequence d' is used as a new donor site, creating a novel extra exon.
Use a codon chart determine the amino acid sequence. Remember to read through the strand and ONLY start after the promoter and STOP when it tells you to stop. Follow example below: Example: DNA AGA TATA TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA O protein AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG start-glu-ala-thre-hist - asp-glu-threo-stop met DNA CCT ATA TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC mRNA DGGA UAU) AUG uGul Gcc nccl cAul GCol protein ly Tur MeT cys AlA ser HIJ Ala 2 3 4 DNA AGA ACT ATA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA protein DNA TAT ATAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC mRNA protein D DNA TAA ACT ATA TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA protein Auu UGA UAU AGU GAUCGA AUC MAG Auu AAU leu Stop. TRY-Met-Asp- ARG-Isle-Stop-Ile. Asn DNA CTA TTT ATA TAC TAG AGC GAA TAG AAA CTT ATC ATC mRNA protein D DNA CAT ATA TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG…
What is the purpose of the underlined sequence? 5’ CAGGGTAGGTACTATGCCTGGATGCCATGGGTAAGGACTAATAAAG 3’ Answer choices The signal to add a 5’ methyl-guanosine cap to the mRNA sequence recognized by the small ribosomal subunit for translation the signal to add a stretch of adenines to the mRNA Sequence that promotes transcription in eukaryotes the recognition sequence for the sigma factor of the RNA polymerase
Shown below is an eukaryotic gene. Assuming normal wild type RNA processing in a.cell, which of the following mature MRNAS could result in normal levels of functional synthesized proteins? Select all that apply Direction of transcription Promoter Template strand 5' Exon 4 Intron 3 Exon 3 Intron 2 Exon 2 Intron 1 Exon 1 3' 5' Coding strand Transcription start Transcription start 5' CAP-Exon1-Exon3-Exon4-AA..AAAA 5' CAP-Exon1-Exon2-Exon3-Exon4-AA...AAAA 5' CAP-Exon1-Exon2-Exon3-Exon4 Exon1-Exon2-Exon3-Exon4-.....AAAA