Q: Make a flowchart for the procedure of SPREAD PLATE METHOD
A: The spread plate method is a method to plate a fluid sample containing bacteria with the goal that…
Q: Trace the path of filtered fluid.
A: Urine formation involves three steps 1. Ultrafiltration - In this step, filtration of blood occurs…
Q: Using a diagrammatical presentation show how serial dilution was performed if the final volume in…
A: Serial dilution is very useful process for diluting the sample and it is also helps in the…
Q: 50 μL of patient serum 50 μL of diluent 50 µl of diluent 50 d. of diluent
A: A serial dilution is any dilution in which the concentration decreases by the same factor in each…
Q: 2. Show a graph of the relationship between temperature and reaction rate
A: Effect of temperature on salivary amylase: The rate of reaction generally increases…
Q: If 0.1 ml is added to 99.9 ml medium, this results in a dilution of: Select one: а. 10-3 b. 10-4 С.…
A: Dilution is a process of decreasing the concentration of solute present in a solution. Dilution is…
Q: Answer the following questions Explain in your own words how the water-resistance test (performance…
A: The ISO 10993-10 test (performance test) applies to devices which come in contact with body fluids…
Q: Explain why the following steps are essential during subculturing:a. Flaming the inoculating…
A: A microbial culture made by transferring the cells from the previous/old culture medium into a fresh…
Q: What are the ingredients Its uses in hemodialysis Explanation (AK 200 Ultra S) of the device, even…
A: Introduction Hemodialysis:-It is a process by which a machine is used to filter urea and other…
Q: In using the centrifuge machine, how will this be remedied if there are only 3 separate liquid…
A: Centrifuges are laboratory equipment that is used to separate components in a mixture based on their…
Q: Draw a serial dilution that would give a dilution of 1/153 000 000. Each tube in your dilution…
A: Different concentrations of chemicals are required in the laboratory for various investigations. In…
Q: You perform a series of 4 different dilutions of 200 µL of sample into 800 µL of saline. What is the…
A: Dilution factor can be calculated using the formula:C1V1=C2V2
Q: Explain the clinical significance that could be associated with each reagent on the urine test strip
A: A urine test strip is a basic diagnostic tool which is used to measure pathological changes in the…
Q: A. Discuss the procedure and give the advantages and limitations of: 1. Kato - Katz Technique 2.…
A: Several techniques can be employed in the laboratory to find out or diagnose the specific disease or…
Q: Calculate the number of PFU/ml in the stock bottle. 1.0 ml 1.0 ml 1.0 ml # 1 # 2 # 3 99 ml 99 ml 99…
A: PFU is also called as plaque forming unit. It is a bacteriophage capable of productively infecting a…
Q: Calculate the CFU present in 100 mL water sample and b) dilution factor in Tube 5.
A: Answer a - CFU present in 100ml solution=58×104 CFU/ml= 580,000 CFU/ml CFU present in 100ml sample=…
Q: Identify whether the statements are TRUE or FALSE 1. You should use P-20 micropipettes to transfer…
A: Pour plate is a technique , in microbiology in which the quantity of the colony-forming units of…
Q: Explain why the following step are necessary during subculturing: Flaming the neck of…
A: Aseptic technique-Aseptic technique should be observed whenever microorganisms are transferred from…
Q: An original sample of water containing 4.00 X 106 CFU/mL was diluted by 4 successive 1/10 dilutions.…
A: Number of colonies in the stock suspension = number of colonies plated * 1/ml* Dilution factor here…
Q: 1/2 dilution
A: Dilution solution contains stock solution or solute and a diluent also known as solvent. Since we…
Q: How could calculate this serial dilutions probelms for microbiology and how do can I know what tube…
A: Serial dilution is a method of step-wise dilution of bacterial culture to reduce the concentration…
Q: Idenitfy the statements whether they are TRUE or FALSE 1. You should use P-20 micropipettes to…
A: INTRODUCTION Spread plate : A liquid broth of bacteria is spreaded on a solid agar suface so that…
Q: Paraphrase the text below: Series of test tubes were filled with the desired volume of the BSA…
A: Proteins are the macro molecules that are made up of amino acids as monomer units. Aminoacids are…
Q: rrect Question 33 You performed a serial dilution and obtain the following results: Dilution factor:…
A: CFU( colony forming unit)
Q: Immediately after stirring 1 hour after stiring Original misture Suction filiration Figure 1 Figure…
A: Mixtures are defined as materials containing 2 or more chemical substances mixed together. In case…
Q: What is the significance of reporting the color and consistency of a stool specimen? Explain…
A: One of the most crucial aspects of the treatment process is the diagnosis. They’ve ordered when…
Q: How do you calculate the initial concentration of a sample? 2. Indicate whether you think that…
A: The concentration of a sample is the number of moles of solute particles present in a liter of…
Q: A student performs a serial dilution but is not careful about the correct procedures for using the…
A: When a substantial drop in concentration is necessary, it is far more precise to do numerous smaller…
Q: In tabular form, provide the principle behind the reaction provided by each pad on a 10-parameter…
A: Dipsticks are sticks on which several reagents are fixed. Dipsticks are useful as an indicator of…
Q: A test procedure calls for 5 mL of undiluted specimen. 2 mL of a 1:50 dilution is used. The answer…
A: Dilution is a procedure of reducing the concentration of a sample. This is usually performed by…
Q: 2. a) Calculate the CFU present in 100 mL water sample and b) dilution factor in Tube 5. Consider…
A: CFU/ml = [number of colonies × Total dilution factor]/Volume of cultured plate. As plate 3 is with a…
Q: What is the estimated size of the specimen under a 10x10 ocular micrometer under HPO? (Take note:…
A: The specimen size can be calculated by using the number of ocular units occupied by it. Here simply…
Q: specimen must not be frozen nor placed
A: Introduction:- Specimens should be collected on clean, wide-mouthed plastic containers with a tight…
Q: Describe what the reverse pipetting technique consists of and in what cases it is used. use in the…
A: Volumetric pipette is used to measure exact amount of a solution. Volumetric pipettes are always…
Q: Please explain and cite references if possible. Thank you! 1. List down 4 factors to consider in…
A: When stool sample cannot be examined in the prescribed interval. No longer than 24 hours stool…
Q: Explain how spirometer tests are done and recorded and how Peak flow tests are done and recoreded.
A: *Spirometer tests done using the spirometry. *Spirometry an instrument that measures airflow. *It…
Q: Determine the CFU/ml for each of the following. 1. Dilution Plate #1 | Plate #2 | CFU/ml 10-2 110 |…
A: Specific bacteria can be isolated from mixed culture by using various plating techniques like the…
Q: If you prepared a tube with 10-2 dilution and from this 0.1 ml ia taken into 9 ml medium, the new…
A: Given Initial concentration 10-2 Volume taken = 0.1ml Volume added = 9 ml Find final dilution…
Q: SAMPLES THE DEVICE 1. rheometer 2. catatermeter 3. anemometer 4. Krotov's apparatus 5. luximeter
A: INTRODUCTION The indoor environment is extremely complicated. Both outdoor and indoor air contains…
Q: Determine the number of bacteria per ml. of water specimen. 1ml 1ml 1ml water specimen H,0 blanks…
A: The aim of the serial dilution approach is to estimate the concentration of an unknown sample…
Q: After placing sample in this instrument, what are the names of two fractions in the tube (choose all…
A: Centrifugation is the process by which components of a solution are separated from one another based…
Q: You need to administer furosemide (Lasix) 2 mg/minute via continuous IV infusion on a controller.…
A: Physician's order is to administer furosemide 2 mg/minute via continuous IV infusion Dose available…
Q: You aseptically transfer 1 mL of your original liquid culture into 99 mL of sterile water. You then…
A: A serial dilution is any dilution in which the concentration is decreased by the same factor in each…
Q: Use the dilution scheme to answer. The concentration of bacteria in the original sample is CFU/ml.…
A: The Entire Viable Count refers to the total number of colonies (TVC). The cfu/ml (colony forming…
Q: Well 1 contains 20 uL of serum. Wells 2-6 contain 90 uL of water. To do a serial dilution of 10%…
A: 10% serial dilution is mixing 1 part of stock solution with 9 parts of diluent so that concentration…
Q: TUBE 1 TUBE 2 TUBE 3 TUBE 4 TUBE 5 Volume pipetted Total volume Sample volume: Total volume (ratio)…
A:
Q: After placing sample in this instrument, what are the names of two fractions in the tube (choose all…
A: Centrifugation is a method used for the separation of particles suspended in liquids or solutions.…
Q: Blood added with 25 ml distilled water + submerged in water bath, added 1-2 drops of 10% acetic acid…
A: Organic molecules are considered to be complex molecules that contain carbon and are mainly…
Step by step
Solved in 4 steps with 1 images
- 3:53 1 + t A 42.0 KB/S 7i ul l 62 chegg.com/homework-h 1 home / study / science / anatomy and physiology / anatomy and physiology questions and answers / asked with an image Your question has been posted. We'll notify you when a Chegg Expert has answered. Post another question. O Next time just snap a photo of your problem. No typing, no scanning, no explanation required. Get Chegg Study App Question: O Edit question Nerve Origin Movements muscles innervated Cutaneous or sensory innervation allary radial Muscilo-cutaneous ulnar median obturator Femoral nerve tibial Common fibular nerves Deep fibular nerve Superficial fibular nerve Sciatic nerve Gluteal nerves Pudendal nerves Mioinguinal nerve Lumbosacral nerves Expert Answero This question hasn't been answered COMPANY LEGAL & POLICIES CHEGO PRODUCTS AND SERVICES CHEGO NETWORK About Chegg Chegg For Good College Marketing Mobile Apps EasyBib Internships.com Advertising Choices Cheap Textbooks Cookie Notice Chegg Coupon Sell Textbooks…in Course: 23SPCMP Anat & Phys... The tissue type that is indicated by the black line is @ # M Question 32 - Lab Practical 1 -... $ % LM 320x 4+Flonase NS #1 ii sprays in each nostril QD. How many days will the medication last?
- Based on the image below, select the correct statement. Complex II QH₂ Q- 10 2 HO 2 HO Fe-S (2.8 FADH₂ FAD- Succinate Fumarate https://canvas.uts.edu.au/assessment questions/356986/files/1562694/download? 2e verifier-eUTT3hYal2YYTWlywV8TIFA3USmzCsM52jECmvTo O Succinate is reduced to fumarate O Succinate is oxidised to FAD O The Fe-S center shuffles electrons from FAD to ubiquinone (Q) O The Fe-S center shuffles electrons from FADH2 to ubiquinone (Q) The Fe-S center shuffles electrons from FADH2 to ubiquinonol (QH2) W 88 16°CThe order is for Streptomycin 1gm IM. You have a 5gm vial of Streptomycin . The label states to add 9ml of sterile water to yield 400mq / m * l How many ml will you give?regular set Clo drepps la) The lv is In fusing 125 drups Imin with ar How long will It taire to Infuse 25oml?
- Prescibed The physici severe Inflammatium. The medicationis available pouder in a vial that confains o-59 After recenstitution, each Sml will confain 0-59 of solu - medrolo Huw many mLs wnd the nurse draw up to give the prescribed duse ? 125mg of Sulu -medrol for aHindII --- 5' GTC - GAC 3', HaeIII --- 5' CC - GG 3', EcoRI --- 5' G - AATTC 3' and BamI --- 5' CCTAG - G 3' 5' AGAATTCTTACGCCGGACGTACCTAGGTTTAGTCGACTC CGCCGCCCCTAGGGTCATCA 3' 3' TCTTAAGAATGCGGCCTGCATGGATCCAAATCAGCTGAGGCGGCGGGGATCCCAGTAGT 5' Number of pieces of DNA , and blunt end fragment (s), and sticky end fragment(s)Dr. Kavorkian orders 10.00 g of a medication for your patient. If each tablet contains 200.0 mg of medication, how many tablets are needed ? (identify the conversion factor, 1 tablet = ?) %3!
- A- B ↑ ↑ C- An image of a hematocrit blood test is shown. Indicate which layer refers to the buffy coat. A B ОсQ:-What is a xaxim?in Course: 23SPCMP Anat & Phys... The tissue type that is shown in this image is @ 2 W 3 Q E $ 4 M Question 40 - Lab Practical 1 -... R % 5 T Be as specific as possible. * 8 + ( 9 GThe tissue type that is she LM 500x H P