Q: The above figure shows the transcription of a gene. True or False The RNA polymerases are…
A: Transcription: The process through which the enzyme RNA Polymerase transfers information from one…
Q: dehydrogenation
A:
Q: Scientists studied what caused leaf shedding in a drought deciduous (=shedding leaves during the dry…
A:
Q: Q4.16. Your colleague designed a common garden experiment to determine if moisture level influences…
A: Introduction :- Any of the numerous green, red, or brown organisms that primarily grow in water are…
Q: Proteins play many different and important roles in the body. Explain how all of the types of…
A: Proteins Proteins are made up of long chain of amino acids. To make a protein, twenty different…
Q: 76. During an in vitro experiment, it is found that glucocorticoids inhibit the growth of all neural…
A: Answer is option (A) Acetylcholine release from sympathetic fibres.
Q: DNA replication involves unwinding two strands of parent DNA, copying each strand to synthesize…
A: DNA replication is a process in which new DNA strands are made from the preexisting strands.The mode…
Q: Air moves through a series of cavities, tubes, and openings Also known as inhalation Also known as…
A: The relationship between gas pressure and volume aids in the understanding of breathing mechanics.…
Q: What is the transport topic/issue relevant to the technology of insulin pump in curing or healing…
A: One of the most significant developments in diabetes technology to date is continuous subcutaneous…
Q: The tarsier belongs in the suborder ____ because it shares characteristics with both prosimians and…
A: Introduction The animal group known as primates is diverse. Lemurs, galagos, and lorisids are…
Q: Chimpanzees are referred to as ____ bipeds. a. facultative b. ineffective c. obligatory d. habitual
A: Introduction The chimpanzee (Pan troglodytes), also referred to as the chimp, is a species of great…
Q: (D) The addition of tryptophan to the growth medium of an E. coli trpR mutant lowers the expression…
A: Ans . D) Tryptophan (trp) operon is present in bacteria which is mainly responsible for producing…
Q: List down 5 adverse effects of a nuclear meltdown both to the ecosystem and to humans.
A: A nuclear meltdown is a severe nuclear reactor accident that results in core damage from…
Q: Describe two ways that decreasing temperature would affect the rate of diffusion of molecules across…
A: To go through the two ways that lowering the temperature will impact how quickly molecules diffuse…
Q: Euprimates
A: Phylogeny of Primates: These are one of the most diverse orders of living mammals with 80 genera…
Q: 2 APA Citations- X X Q Maya islamic pro X 8/25 Milwaukee Landin X 0% Genetics Test Revi X…
A: Incomplete dominance is a form of intermediate inheritance in which one allele for a particular…
Q: 4. How many grams of protein are in this product? 5. What is the total carbohydrate daily total…
A: In many nations, the nutrition information label, which lists the carbohydrates, fat, total…
Q: The genotype Gg would be an example of which? Group of answer choices Heterozygous homozygous…
A: If there are two different kinds of alleles (one dominant and one recessive) , then the genotype…
Q: The outer most layer of bone is called: A) Periosteum B C Cortical bone Spongy bone Medullary cavity
A: Bone is a tissue that is made up of cells that produce an extracellular matrix that is mineralized…
Q: Glycogen synthesis and glycogen breakdown are catalyzed by separate enzymes. Contrast the reactions…
A: Glycogen is a carbohydrate, which is a polymer of glucose. Glycogen is also stored in human body as…
Q: Which type of connective tissue typically stores fat? A Blood B) Fibrous connective tissue Adipose…
A: That tissues which are derived from embryonic mesoderm, present throughout the body to support and…
Q: Where does genetic foresight lead us?
A: introduction: Genetic Foresight offers a genetic test that sequences specific segments of patients'…
Q: Childhood trauma may lead to Chronic inflammation regardless of current depressive symptoms…
A: All those events in the childhood which cause emotional distress in a child is known as childhood…
Q: Write all possible codons recognized by each of the given anticodons. An anticodon strand reads…
A: Anticodon is a sequence of three nucleotides found on one arm of the transfer RNA, also known as the…
Q: Which type(s) of chromosomal aberrations result from chromosomal breaks on different chromosomes?…
A: <!--<SUB-PART>--> (a) <!--<SUMMARY-INTRODUCTION>--> To Determine: If the…
Q: glomerulus glomerular capsule loop of nephron renal vein proximal convoluted tubule McGraw Hi B…
A: The structural and functional unit of kidney is called Nephron. 85% of nephrons are present in the…
Q: What is one structure that you will never find in a human cell? O cell wall O nucleus O cell…
A: The fundamental units of all living creatures are cells. There are many billions of cells in the…
Q: Streptococcus pneumoniae 20....... Enterococcus faecalis Organism Streptococcus salivarius COMPLETE…
A: Organism Growth Alpha hemolysis Observed Beta Hemolysis Observed Gamma (No) Hemolysis Observed…
Q: QUESTION 29 Which pathway requires NADPH? Check all that apply: cholesterol synthesis…
A: In living organisms all the biochemical reactions requires enzymes. Enzymes need co-enzymes for…
Q: Microbial link between Western-style diet and incidence of colorectal cancer uncovered.
A: **New research builds the case that a western-style diet-rich in red and processed meat, sugar and…
Q: 8. Which statement best describes the processes used by autotrophs and heterotrophs? a. Plants use…
A: Autotrophs are those organisms which are able to make their own food. They are also known as…
Q: What are some selective advantages of being an efficiently bipedal hominin?
A: Evolution is a steady phenomenon which transform life from simple to more complex. Theories that…
Q: *REQUIRED 34. The diagram below represents one of a number of different types of mutations that can…
A: The correct answer is option C. The substitution of an adenine (A) base for guanine (G). We can best…
Q: B B 2 4 B 1 b 3 be white. In mice, black fur (B) is dominant to white fur (b). According to the…
A: Given: In mice, Balck fur (B) is dominant. White fur (b) is recessive. Cross between BB x Bb. B…
Q: Describe the structure of fungi.
A: Since fungi are heterotrophs, they are unable to manufacture their own food. As an alternative, they…
Q: Which of the following is the overall role of the musculoskeletal system? A Transport of essential…
A: Transport of essential molecules including nutrients and gases throughout the body: It is the role…
Q: early hominin femoral heads
A: Femur: It is also called as the thigh bone. It is the large upper leg bone which connects the knee…
Q: 1. Which of the following characterizes the metabolic state during the third trimester of a normal…
A: Individualized diets are used to meet increased fetal and metabolic needs, taking into account…
Q: 6. Fill in the blanks and select the correct option [ A/B/C] in the paragraph below. Although both…
A: Cellular respiration: The process by which the cell utilizes the biochemical energy obtained from…
Q: What are mycorhizza and if there were none, what would be the impact on the planet and ecosystems?
A: In our ecosystem there are different types of inter-species relationship. Mutualism is one of them.…
Q: Which of these statements concerning enzymes is correct? a. Enzymes increase the rate of reactions…
A: Enzymes- Enzymes are generally protein molecules. They help in lowering the activation energy of a…
Q: Describe all NADH and FADH2 production through the cellular respiration of one glucose molecule
A: Cellular respiration involves production of energy (ATP) by the breakdown of glucose in the presence…
Q: are chimpanzees classsified as bipeds?
A: Please follow step 2 for detailed explanation.
Q: An experiment was carried out to determine whether drinking caffeinated soda increases pulse rate.…
A: The pulse rate is the dependent variable in the designed experiment. So the correct answer is option…
Q: are
A:
Q: The plot shows that Australopithecus afarensis is most similar to ____ in its limb proportions. a.…
A: The plot shows that Australopithecus afarensis is most similar to option a. Terrestrial quadrupeds…
Q: In a mouse mutant, all Norepinephrine (NE) synapses in the thalamus have a Protein Kinase A that…
A: Ans : Protein kinases belongs to the family of enzymes that phosphorylates the target protein by…
Q: Which organ in the digestive system is the main absorptive site where digested end particles are…
A: The digestion process breaks down complex food particles into simple absorbable units.
Q: Figure 6.10 If no activation energy were required to break down sucrose (table sugar), would you be…
A: The minimal energy input needed for all chemical reactions to take place is known as the activation…
Step by step
Solved in 2 steps
- A scientist mutates elF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of elF-2 alter translation? Initiation factors would not be able to bind to mRNA The large ribosomal subunit would not be able to interact with itiRNA transcripts tRNAi-Met would not scan mRNA transcripts for the start codon elF-2 would not be able to interact with the small ribosomal subunit.Add-ons Help Last edit was 4 minutes ago Times New.. - BIUA 11 + Using the table the other page- transcribe the RNA sequence int codons and their amino acids: CAU TTG TAU UTA AAA TGG GCG Translation Mechanics Now that you are an expert code breaker, we can start to talk about thanslation. Let's go over the key players in the process. MRNA. The mRNA is the code that is translated into a functional protein. It is created through transcription and a series of subsequent editing steps, which we have described in detail already. The mature mRNA comprises codons that will code for the production of a protein. lili 日Of all of the different codons that exist, three of them ___. do not specifiy a particular amino acid and are signals to terminate translation do not specifiy a particular amino acid and are signals to begin translation are involved in mutations cannot be copied give the signal to stop translation
- Initiation of translation begins when the ____. Ribosomal small subunit binds to the 5’ end of the mRNA Large and small subunits link together, then bind to the 3’ end of the mRNA Small and large subunits bind to the start codon followed by the initiator tRNA None of the above3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…TRANSCRIPTION ein The DNA provided for your animal is one side of the double helix. DNA - MRNA 1. Transcribe the DNA strand into mRNA. Don't forget the special base pair ham AU rules for RNA! VERSION 2 TA Fuentes- 2. Translate the mRNA into an amino acid chain. Notice that this is broken into 1 i nucleotide sequences called CODONS. Use the codon chart to find the i correct amino acids. Remember, translation for each chain always starts with the amino acid methionine (Met) and ends with one of the stop codons (UGA, UAG, UAA). C G G C ity you Co deter y Fuentes- code DNA TAC TGG GGT GT C стс TAG CTA ATC TAC IG G AC G cCc ACC GGT ATG ΑΤΤ thousar ytakes And se MRNA d or create AA Turn in 1l tables DNA TAC CAT TAC C GT CCC TC G GT T AT C TAC AAC AGG CCT TT G GC T CCG ACT MRNA thesis nments AA to Sean Che comme DNA TAC TTG GT T CT C CT G тст ACA ACT TAC CAT CGA TTG GGG T G T TAG ATC S comm MRNA AA Decide if you want to illustrate a horse, coyote, or a cat - get the phenotype information from…
- The eukaryotic mature mRNA sequence will be translated into a polypeptide that is _____ amino acids long (hint remember to "be a ribosome" and scan for the AUG and look out for stop codons!). 5’-CCATTCAUGUUUGGUGGCUAACCA-3’TRANSCRIPTION The DNA provided for your animal is one side of the double helix. DNA - MRNA otein 1. Transcribe the DNA strand into mRNA. Don't forget the special base pair → rules for RNA! AU TA VERSION 1 2. Translate the mRNA into an amino acid chain. Notice that this is broken into 1 nucleotide sequences called CODONS. Use the codon chart to find the correct amino acids. Remember, translation for each chain always starts with the amino acid methionine (Met) and ends with one of the stop codons (UGA, UAG, UAA). C G Cheatham G C oints Fuer DNA TAC ATA A CA GTC стт TAG CT A AT C TAC T GG ACA GGT ACC ATA ACT = activity you mber to deter = may code Fuer MRNA veral thousar ctivity takes on 2). And se AA o pp DNA TA C C G T CcC A GT GT C T G C A A A ACT TAC GACAGC TAC GT G G C T сс ATC Turn in lete all tables MRNA AA n Synthesis mment DNA TAC сТА CT T G T C T T G G C C ACG AT T TAC CAT C C G GA C GG G TAC T TA A T C Class comme to Sea aclass comm MRNA AATRANSCRIPTION The DNA provided for your animal is one side of the double helix. DNA - MRNA | 1. Transcribe the DNA strand into MRNA. Don't forget the special base pair rules for RNA! AU TA veRSIon 2 2. Translate the MRNA into an amino acid chain. Notice that this is broken into 1 i nucleotide sequences called CODONS. Use the codon chart to find the i correct amino acids. Remember, translation for each chain always starts with the amino acid methionine (Met) and ends with one of the stop codons (UGA, UAG, UAA). C G G C IGG GGI G IC CIC IAG CIA AIC Iac IGG ACG ccc Acc AI G DNA TAC GGT ATI MRNA AA DNA TAC CAT I AC CGI cCc IC G GTT A IC IA C A AC AGG CCI IIG GCT CCG ACI MRNA AA DNA I AC I T G GII CIC CIG ICI A C A ACI IAC CAI CGA IT G G GG TGI TAG A T C MRNA AA Decide if you want to illustrate a horse, coyote. or a cat - get the phenotype information from your teacher.
- Many primary transcripts of noncoding RNAS must be _in order to be functional. * none of the above replicated O polyadenylated translated O processedNeed help Below is a strand of mRNA with three codons listed on the strand. Imagine the mRNA strand is in the cytoplasm of a cell and translation is in progress. Draw and label all the necessary main players needed for translation to occur. Included in your drawing should also bee 3 tRNAs , these 3 tRNAs should represent two different forms of tRNA. MRNA 5' ------------AUG------------AGG----------GAGmRNA sequence of A gene Find start codon and stop codon 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’