These sequences are obtained as part of a human genome sequencing project using a library of 150 kb fragments in BAC clones. A computer aligns the sequences based on overlap to make contigs. 5' ААСТТАGGGCTAGCC 3' 5' GGCTAGCCAAATTCG 3' 5' CTAACGTCGAATTTG 3' How many contigs are represented by this set of DNA sequences? Multiple Choice 1 3 2

These sequences are obtained as part of a human genome sequencing project using a library of 150 kb fragments in BAC clones. A computer aligns the sequences based on overlap to make contigs. 5' ААСТТАGGGCTAGCC 3' 5' GGCTAGCCAAATTCG 3' 5' CTAACGTCGAATTTG 3' How many contigs are represented by this set of DNA sequences? Multiple Choice 1 3 2

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF?
Table I CACGT A GA CTGAGG ACTC CACGTAGACTGAG G ACAC Wild-type beta-globin gene fragment Sickle-cell beta-globin gene fragment > Circle the mutation in DNA of the sickle-cell beta-globin gene fragment Compare fragments of DNA the wild-type and mutant beta-globin genes in the Table I above, what are the similarities and differences you observe?
In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’
In the following gel showing stained bands of the Alu insertion sequence, what is the genotype of individual 2? 941 bp 641 bp->>> 1 2 3 4 5 6 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertion
In a standard procedire, when writing and reading base sequences for nucleic acids (both DNA and RNAs) always to specify base sequence in 5' > 3' direction unless otherwise directed 1. From the base sequence 5' A-T-G-C-C-A 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand 2. From the base sequence 5' T-A-A- C-C-T 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand
There are numerous methods for sequencing DNA, including classical Sanger sequencing, automated Sanger sequencing, and next-generation sequencing technologies, including Illumina technology. Match the modified cytidine nucleotide triphosphates (NTPs) with DNA sequencing methods that utilize them. Classical Sanger sequencing HO-P=O O HO-P=O O HO-P=O O Automated Sanger sequencing -NH₂ CH3 H₂CN ° ? ?N HOOOO OH OH OH NH CH₂ Next-generation DNA sequencing (Illumina) CH₂ NH₂ Answer Bank
A 13-nucleotide section of an autoradiogram from a Sanger sequencing experiment is depicted in the image below. Based on the band pattern observed here, write out the sequence of both the complementary strand generated during the experiment, and the template strand that is being analyzed. Be sure to clearly indicate the 5' and 3' ends of each. ddATP ddGTP ddCTP || | | ddTTP | 3' 5' Tyne a short answer in the space provided below
1、You have a 250 bp DNA sequence from a human protein-coding gene. What's the best tool to find out which gene matches this sequence? BLAST A Clustal algorithm (such as Clustal Omega) A Burrows-Wheeler algorithm (such as BWA) Just Google it 2、Sequence alignment algorithms like Burrows-Wheeler were primarily designed to handle many (millions) of short sequences and match them to a reference genome efficiently. Another property of these algorithms makes them suitable for use with RNAseq data. What property is this? Burrows-Wheeler can distinguish which strand of reference genome matches a sequencing read. Burrows-Wheeler can align a sequencing read that matches two different exons. Burrows-Wheeler uses a pre-compiled and compressed index of the reference genome. Burrows-Wheeler can be parallelized.
BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
The following DNA sequence was determined by Sanger sequencing, using a 20 nt long sequencing primer that ended ...AGTACAACAA-3'. 5'-agtacaacaa ctctcggtc tacggtacgc ctgcgggcgc gtagccaatc tagcacttcg-3' 3'-tcatgttgtt gagagccag atgccatgcg gacgcccgcg catcggttag atcgtgaagc-5′ A. If the technician forgot to add ddNTPs to the reaction, what would the sequencing chromatogram look like? Blank Many peaks, but only one at each position Overlapping peaks at every position All peaks are black There is only one peak, at 60 nt B.When the reaction is done correctly, ddCTP is labeld with a yellow fluorescent tag. When the Sanger sequencing reaction is complete, what will be the lengths, in nucleotides, of the three shortest products that have the yellow tag? C. Could you perform Illumina sequencing using ddNTPs? Why or why not? Explain.
You were going to sequence a rice DNA fragment whose sequence was only know at one end, as shown below. 5’ AAACGATCGAGTCGCATCCAAAATCGATACCC—unknown region 3’ TTTGCTAGCTCTGCGTAGGTTTTAGCTATGGG—unknown region After several tries, you obtained a beautiful sequencing image as shown here: The worked out well partially because you had designed a primer for sequencing the unknown region according to the following guideline: Tm is 55 – 60°C. Ensures primer had a appropriate melting temperature for PCR ans sequencing. The GC content of the primer is the same as the genome/template (rice = 60%, human/Drosophila = 45-50%). A same nucleotide cannot be more than 2 in a row, e.g. CCC, GGGGG, AAA. The secondary structure of the primer must be none or weak. No primer dimers (The primer anneals to itself). 3’ end is the most important: it should not end in A, preferably ends in GG, GC, CG or CC This website can help you design the primer: http://www.oligoevaluator.com/OligoCalcServlet…
The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…