These are written as either accurate or contain errors. Rewrite each one with an error as an accurate statement. Please have an explanation. Thank you! An insertion mutation is not as severe as a transversion because the transversion changes the reading frame within the RNA. SINES, LINES and SNPs are three common types of repetitive sequences.
Q: Errors are occasionally made during the process of transcription. Explain why these errors do not…
A: Errors are occasionally made during the process of transcription and these errors do not always…
Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…
A: Introduction :- mRNA stands for messenger RNA. The nucleus uses the nucleotide sequence of DNA as a…
Q: Identify the type of mutation that occurred to produce the abnormal hemoglobin. Explain why you…
A: Nonsense mutation: This is a condition in which a protein loses its function, resulting in sickness…
Q: Sickle cell hemoglobin DNA CACG T AGACTGAGGA CAC Sickle cell hemoglobin MRNA ickle cell hemoglobin…
A: According to the question, we have to mention the type of mutation present in Sickle cell anemia…
Q: Direction: On the worksheet, all the DNA sequences run from 3' to 5'. Supply the corresponding amino…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: An mRNA transcript has the following complete sequence: 5'-AUGCCUACGUUACGGACC-3' Rewrite the…
A: Missense Mutation: A missense mutation is a point mutation that results in a codon that codes for a…
Q: 36. Answer and explain
A: A codon is a three-nucleotide sequence of mRNA that corresponds to a specific amino acid or stop or…
Q: DNA sequence specificity of the CRISPR Cas9 complex is determined by: Group of answer choices None…
A: CRISPR is the kind of bacterial adaptive immunity. Bacteria binds viral DNA to it's genome to make…
Q: An insertion of two nucleotides into a gene results in a frameshift mutation. This statement is:…
A: The nucleotide sequences found within a DNA molecule are subject to change due to a phenomenon known…
Q: Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino…
A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…
Q: An inappropriate base change that has no discernible effect is called a _____________ mutation.
A: The mutation is the process, which helps to change the bases in the DNA segment and exert different…
Q: A nonsynonymous mutation is also referred to as missense mutation. Which of the following correctly…
A: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to external…
Q: The variation in the length of tandem repeat of microsatellite DNA has serious translational affects…
A: Microsatellite is a repetitive DNA sequence, in microsatellite some DNA motifs are repeated for so…
Q: Same sense mutation is usually non-destructive due to the degeneracy of codons. Group of answer…
A: Same sense Mutations are the point mutations that lead to form a different codon but it is…
Q: DNA primase synthesizes a short RNA primer that later appears at the 5'-end of each Okazaki…
A: The given statement is TRUE
Q: A. The insertion shifts the reading frame to the right .The deletion frameshifts the reading frame…
A: *NOTE: Kindly repost for other questions Dear Student as per the guidelines we are supposed to…
Q: When referring to the amino acid sequences of proteins, sequence homology is the same as sequence…
A: single mutation leads to a homologous protein, and yet may drastically change the structure and/or…
Q: Write TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. A glycosidic…
A: Similar to Deoxyribose Nucleic Acid(DNA), RNA(Ribose Nucleic Acid) is a linear polymer composed of…
Q: Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that…
A: Mutation is defined as the change in the nucleotide sequence of DNA.
Q: codon usage bias
A: ᴍᴜᴛᴀᴛɪᴏɴ ɪꜱ ᴅᴇꜰɪɴᴇᴅ ᴀꜱ ᴀ ᴄʜᴀɴɢᴇ ɪɴ ᴛʜᴇ ɴᴜᴄʟᴇᴏᴛɪᴅᴇ ꜱᴇQᴜᴇɴᴄᴇ ᴏꜰ ᴀ ɢᴇɴᴇ ᴏʀ ᴀ ᴄʜʀᴏᴍᴏꜱᴏᴍᴇ. ᴡʜᴇɴ ᴏɴʟʏ ᴏɴᴇ…
Q: The transcribed portion of a DNA sequence for a gene is shown below. Identify the MRNA sequence and…
A: The procedure of determining the order of the four nucleotide bases (adenine, thymine, cytosine, and…
Q: DNA mutations can affect the reading frame for the genetic code. What is a human condition caused by…
A: The cell is the basic structural and functional unit of the body. The nucleus is called the brain of…
Q: The following statements are either accurate as written or contain some errors. You need to rewrite…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: DNA mutations can affect the reading frame for the genetic code. What is a human condition caused by…
A: Mutations are the changes in the genome resulting in synthesis of different products. These changes…
Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…
A: The process of synthesis of proteins from mRNA is called as translation while the process of…
Q: The following sequence of nucleotides is found in a single-stranded DNA template:…
A: The process of formation of mRNA from DNA is called transcription.
Q: rmal hemoglobin is created from the codon GAA, which codes for glutamic d while sickle-cell…
A: Any abrupt change in the DNA sequence of nucleotides results in mutation its effects may be diverse…
Q: Although RNA polymerase is a processive enzyme that remains attached to the DNA over long stretches…
A: RNA polymerase is an enzyme that assists in the transcription process by copying a DNA sequence into…
Q: Explain how the mRNA vaccine work and relate to protein synthesis (Moderna and Pfizer vaccines are…
A: mRNA (messenger RNA) is a single-stranded molecule found in all of our cells. It transports the…
Q: Which of the following statements is TRUE of highly repetitive sequences? O They can be found…
A: ANSWER;- a)They can be found millions of times in a eukaryotic genome. Explain;- DNA sequences…
Q: EboV from Guinea pig Reference DNA Sample mRNA Protein
A: The tiny living creatures such as bacteria, viruses, fungus, algae, and protozoa have a significant…
Q: Which of the following statement(s) is/are true. You can select multiple options. Select all that…
A: Insertion or deletion of 3 or more nucleotides does not cause frame shift mutation. Frame shift…
Q: Show the effect of the following types of mutation on the 5th N-base of the given DNA sequence. Use…
A: A missense mutation is a mistake in the DNA which results in the wrong amino acid being incorporated…
Q: E A F AUCG 1w 會1 C O a O b A G LL
A: The tRNA has a distinctive folded structure with three hairpin loops that forms the shape of the…
Q: Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino…
A: Transition refers to a point mutation that changes a purine nucleotide to another purine or a…
Q: A mutation in DNA that changes a glutamine codon, CAA, to a stop codon, UAA, is called a O…
A: Mutations can occur as a consequence of DNA copying errors during cell division, exposure to…
Q: Original sequence Altered sequence protein/ amino acid mutation: DNA nucleotide AUUCGAGUA AUUCGGGUA…
A: A mutation is a sudden, stable and inheritable alteration in the base sequence of a gene which is…
Q: Please fill in missing DNA/RNA/Amino Acid sequences.
A: DNA: DNA is the basic unit of life.The information here is stored as a code which is made up of…
Q: n the given segment, illustrate and indicate the direction of synthesis of: a.) a 5-nucleotide RNA…
A: The replication process initiates with the unwinding of the polynucleotide strand forming a…
Q: Complete each sentence with the appropriate term or phrase. (Each box can be used only once, and not…
A:
Q: Using the codon charts in your text (section 6.1), fill in the chart below. [ /8] Original DNA…
A: The gene expression in the cells is brought about by the various processes of Replication…
Q: Based on the given description, determine which mutation is being referred to A single base…
A: Introduction A mutation is a change in an organism's DNA sequence. Mutations can occur as a result…
Q: In the table below, there are four versions of gene A, one of which is normal, and the other three…
A: Mutations are sudden heritable changes that change gene expression. These changes in gene expression…
Q: 3. Examine the following DNA sequence and determine wh type of mutation, if any, produced the…
A: A heritable genetic change in the genetic material of an organism that gives rise to alternate…
Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…
A: Transcription is a process through which the double stranded DNA transcribes itself into a single…
Q: Define the following terms:a. codonb. anticodonc. genetic coded. open reading framee. codon usage…
A: Molecular genetics is a sub-field of biology that addresses how differences in the structures or…
Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…
A: Conversation of non functional mRNA to functional mRNA is done in many steps.. 1. A…
Q: Tn10 has a ____________ structure and it is composed of a pair of insertion sequence elements (IS10)…
A: Tn10 is a transposable element that instead of replication uses the method of cut and paste. It is…
Q: The following statements are either accurate as written or contain some errors. You need to rewrite…
A: Cells division proceeds through a series of carefully regulated stages of growth, DNA replication,…
These are written as either accurate or contain errors. Rewrite each one with an error as an accurate statement. Please have an explanation. Thank you!
- An insertion mutation is not as severe as a transversion because the transversion changes the reading frame within the RNA.
- SINES, LINES and SNPs are three common types of repetitive sequences.
Step by step
Solved in 3 steps with 2 images
- Mutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ______________________________write a correct terminology/word on column B that meet the description of column A COLUMN A COLUMN B 1. The site for protein synthesis where mRNA and tRNA meets. 2. Benign tumours or warts that might cause problems but do not spread to oyher parts of the body. 3. A nucleotide sequence that is complimentary to the mRNA codon. 4. A condition that depicts injury or diseased state of liver. 5. Term used to describe a process or condition which affects the general body function. 6. A type of virus that attacks the respiratory system to cause flue 7. The fluid found within the cell 8. A condition which describes harm, damage or impairment of kidney function. 9. To spilt a molecule or chemical bond. 10. The protein coat or shell of a virusUsing the codon charts in your text (section 6.1), fill in the chart below. [ /8] Original DNA sequence TAC GGA CAC GTT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Mutated DNA sequence TAC GGA CAC ATT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Type of mutation (highlight all that apply) Frameshift Nonsense Missense Silent Insertion Deletion Substitution
- Original DNA Sequence: T A C G C A A A A A T C G A T C G A A C TmRNA Sequence:Amino Acid Sequence:Mutated DNA Sequence # 1: T A C G C A A A A A T T G A T C G A A C TmRNA Sequence:Amino Acid Sequence:Will there likely be any effects from the mutation? yes or no. Explanation: _________________________________ ______________________________________________________________________________________________What type of mutation is it? _________________________________________________________________Mutated DNA Sequence # 2: T A C G C A A A G A T C G A T C G A A C TmRNA Sequence:Amino Acid Sequence:Will there likely be any effects from the mutation? yes or no. Explanation: _______________________________________________________________________________________________________________________________What type of mutation is it? _______________________________________________________________________Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino acid. A point mutation at the genetic level in each codon results in the change indicated. For each mutation, indicate whether it is due to a transition or a transversion, and then indicate the effect of each mutation at the protein (amino acid level) (i.e. silent, nonsense, missense). In addition, Please note, each of the three lines above an amino acid represents a single RNA base. For example, when you look at the codon chart AUG would stand for Met (methionine) Lys 1 Glu Ile 3 Stop Ile 4.Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino acid. A point mutation at the genetic level in each codon results in the change indicated. For each mutation, indicate whether it is due to a transition or a transversion, and then indicate the effect of each mutation at the protein (amino acid level) (i.e. silent, nonsense, missense). In addition, Please note, each of the three lines above an amino acid represents a single RNA base. For example, when you look at the codon chart AUG would stand for Met (methionine) Lys 2 1 Glu Ile 4 Stop Ile Mutation 1: 1. Circle the appropriate answer: This mutation is a transition/transversion 2. Circle the appropriate answer: This mutation results in a missense/silent/nonsense mutation in the protein sequence. Mutation 2: 1. Circle the appropriate answer: This mutation is a transition/transversion 2. Circle the appropriate answer: This mutation results in a missense/silent/nonsense mutation in the…
- In the text box below, answer the following questions. Remember to label your answers that correspond to the questions, and attempt answering all of the questions to receive full credit. 1. Use the table of the genetic code to complete the following table. The columns represent transcriptional and translational alignments. Label the 5' and 3' ends of DNA and RNA, as well as the amino (N) and carboxyl (C) ends of the protein. end end DNA double G A helix 3' CA U MRNA transcribed G C A TRNA anticodon Trp Amino acidMutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________Based on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: AUGAUUCUUAAAAGU Mutant 1: AUGAUUCUUUAAAGU Mutant 2: AUGAUUCUUGAAAGU Mutant 3: AUGAUCCUUAAAAGU Mutant 4: AUGAUCCUAAAAGU Mutant 5: AUGAUCCUUAAACAGU Socond letter Key: Ala = Alanine (A) Arg Arginine (R) Asn = UUU } UAU Tyr UGU UGC Cys UGA STOP UGG Trp UCU UCC UUC Phe Ser Asparagine (N) Asp = Aspartate (D) Cys Cysteine (C) Gin = Glutamine (Q) Glu = Glutamate (E) Gly = Glycine (G) His = Histidine (H) le = Isoleucine (1) Leucine (L) Lys Lysine (K) Met = Methionine (M) Phe = Phenylalanine (F) Pro Proline (P) Ser = Serine (S) Thr Threonine (T) Trp Tryptophan (W) Tyr Tyrosine (Y) - Valine (V) UCA UCG UAA STOP UAG STOP UUA Leu UUG S CCU CC CGU CUU CUC His CGC Arg Leu Pro CAA Gin CGA CCA CCG CUA CUG CGG Leu = AGU AUU AUC } lle AUA ACU ACC ACA Ser AAC…
- The queation on my assignment is select the description of an exon? the answers they give are: 1. sequence of adenine nucleotides added onto the end of pre‑mRNA 2. modified form of a guanine nucleotide added onto the end of pre‑mRNA 3. coding portion of a DNA sequence that is present in mature mRNA 4. noncoding portion of a DNA sequence that is removed from pre‑mRNA then it wants you to explain your reasoning for your answer that you pickedThe line below represents a mature eukaryotic mRNA. The accompanying list contains many sequences or structures that may or may not be a part of mature eukaryotic mRNA. As accurately as you can, show the location, on the line, of the sequences or structures that belong on the eukaryotic mRNA; then separately list the items that are not part of eukaryotic mature mRNA. 5’____________________________________________________3’ A-stop codon B-poly-A tail C- intron D- 3’UTR E-promoter F- start codon G- AAUAAA H- 5’ UTR I- 5’ cap J- Termination sequenceHello, I would really appiarte help appreciate help. This is a blank question so I am unsure why it was rejected immeditely the first time. Thank you in advance. Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA antisense strand First codon change from TAC to TAT. Third codon change from ACG to ACA. Ninth nucleotide changes from G to T. Nucleotide with adenine (A) base inserted between 3rd and 4th nucleotide. Types of Mutation Changes in the Amino Acid 1. 2. 3. 4.