What are three important elements in the initiation of replication in prokaryotes? Identify and very briefly describe each
Q: Name of a few enzymes involved in DNA replication other than DSNA polymerase and ligase.name the key…
A: Each cell follows central dogma to undergo division and growth. The central dogma has three main…
Q: Why do eukaryotes need multiple origins of replication?
A: Unlike prokaryotes, eukaryotic chromosomes also very often showed multiple origins of replication.…
Q: How many replication bubbles do eukaryotes have?
A: DNA replication occur during the growth phase and eukaryotic cells alternate between the division…
Q: Assume that a certain bacterial chromosome has one origin of replication. Under some conditions of…
A: The replication in bacteria will be bidirectional hence initially two replication fork per Double…
Q: Most prokaryotes have a circular chromosome, with no ends, so the shortening of DNA does not occur.…
A: To forestall the loss of genes as chromosome closes wear out, the tips of eukaryotic chromosomes…
Q: What are the two roles of dNTPs in the process of replication.
A: DNA replication can be defined as the process in which DNA molecules are copied to produce two…
Q: Compare and contrast the origins of replication in bacteria and eukaryotes.
A: Deoxyribonucleic acid (DNA) replication is the biological process by which a double-stranded DNA…
Q: Suppose that replication is initiated in a medium containing moderately radioactive tritiated…
A: Replication is the process of synthesis of DNA strands from the original strands where…
Q: How did the results prove the semiconservative model of DNA replication? Explain.
A: The above experiment is cesium chloride density gradient centrifugation. This experiment was done by…
Q: In what ways is eukaryotic replication similar to bacterial replication, and in what ways is it…
A: The deoxyribonucleic acid is the genetic material that is passed from one generation to another…
Q: In what ways does chromosomal replication in eukaryotes differ from DNA replication in prokaryotes?
A: DNA Replication - Replication is defined as the process in which double-stranded DNA molecules is…
Q: Mention two functions of DNA polymerase I in E. coli replication machinery?
A: The function of the polymerase I is it removes the RNA primers from the okazaki fragments and the…
Q: With regard to DNA replication, define the term bidirectional replication.
A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…
Q: Is eukaryotic replication bidirectional or unidirectional?
A: Deoxyribonucleic acid (DNA) replication is semi-conservative in nature, which implies that each of…
Q: In comparison with prokaryotes, what are some differences in the genome structure of eukaryotic…
A: Genes are the basic structural and functional unit of heredity. They carry coded genetic information…
Q: . Draw a replication bubble with both replication forksand label the origin of replication, the…
A: The area where the replication of DNA occurs called replication fork. When double helix is opened…
Q: List and describe the steps in prokaryotic DNA replication. How does this process appear to differ…
A: DNA replication is the process in which the the double helical structure will act as a template for…
Q: Describe in order, the four repeating steps that repeat over and over on the discontinuous lagging…
A: Replication: it is the process by which new DNA is produced from the old DNA by semi-conservative…
Q: What similarities and differences exist in the enzymatic activities of DNA polymerases I and III?…
A: The process of replication in living cells requires a set of enzymes and DNA dependent DNA…
Q: . Indicate the role of each of the following in DNA replication: (a) topoisomerase, (b) helicase,…
A: The deoxyribonucleic acid (DNA) is a hereditary material that is found in almost all living…
Q: With illustrative diagrams, explain the three theories of DNA replication.
A: The DNA replication is the process of formation of DNA in which one strand of DNA act as the…
Q: How is DNA replication initiated in prokaryotes and eukaryotes? How is this process controlled and…
A: Deoxyribonucleic acid (DNA) is the genetic material found inside a cell's nucleus. The production of…
Q: How many replication bubbles do prokaryotes have?
A: During DNA replication, the helicase enzyme separates the two strands of DNA in a zipper fashion.…
Q: Why do eukaryotic and prokaryotic cells have similarities and differences in the DNA replication?
A: The method of getting two identical duplicates of a DNA strand from the original DNA strand is known…
Q: explain the term semiconservative replication?
A: Numerous trials were led to decide how DNA replicates. Basically, the semiconservative model was…
Q: elow is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA…
A: Without the enzymes, DNA replication is incomplete. The initiation, elongation, termination, and…
Q: Why is a clamp loader necessary in replication?
A: Clamp loader was identified as DNA polymerase processivity factors. Clamps not only increase the…
Q: During DNA replication in E. coli, which enzyme forms the phosphodiester bond between an RNA primer…
A: Ligase unwinds the helical structure of DNA. Topoisomerase breaks the pressure of supercoiling in…
Q: Describe DNA replication. What are Okazaki fragments? Why does each chromosome have thousands of…
A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…
Q: What is replication slippage?
A: In molecular biology, DNA replication can be described as the process during which DNA is duplicated…
Q: What Is The Origin Of Replication? How many are found in prokaryotes and how many are found in…
A: Origin of replication, as the name suggests it's the specific sequence of genome where the…
Q: How does DNA replication in eukaryotes differ from the process in prokaryotes?
A: One of the fundamental processes that happen in a cell is DNA replication. Replication refers to the…
Q: What is one enzyme that is involved with DNA replication and how would the absence of this enzyme…
A: Introduction: Nucleic acids are major macromolecule present in the nucleus of the cell. DNA is a…
Q: In eukaryotes, the Replication factor C (RFC) is a clamp loader. In the absence of RFC, what would…
A: The Replication factor C (RFC) is the accessory proteins that's is essential for the processive DNA…
Q: How did the results prove the semiconservative model of DNA replication? Explain
A: To obtain heavy density DNA, Meselson and Stahl cultured bacteria in a N15 medium. This result…
Q: In eukaryotes, what is meant by the term DNA replication licensing? How does the process occur?
A: BASIC INFORMATION DNA Replication It is the process in which there is production of the replicas…
Q: Why Sanger sequencing uses ddNTPs and how they differ functionally from dNTPs. Does Sanger…
A: Sanger sequencing is the method of sequencing (determining the sequence of DNA) of DNA using the…
Q: If the gene for primase were mutated so that no functional primase was produced, what would be the…
A: DNA replication is the process by which new DNA strands are formed.
Q: In what way that DNA replication in E. coli shares the profound common ground with DNA replication…
A: E. coli, as most microscopic organisms (bacteria), has a single origin of replication on its…
Q: Who presented the evidence that semiconservative replication also occurs in eukaryotic organisms ?
A: Semiconservative replication is the term used to describe DNA replication in all known cells. Along…
Q: What is origion of replication?
A: For the purpose of genetic information and thus chromosomal DNA transmission from one generation to…
Q: If the rate of replication in a particular prokaryote is 900 nucleotides per second, how long would…
A: DNA replication a process by which DNA makes copies of itself and this process requires lots of…
Q: Considering prokaryotes, what is the enzyme that synthesizes RNA primers needed to start…
A: DNA replication means the synthesis of daughter DNA strands using the parental strands as a…
Q: Name an important difference in the replication of circular DNA versus linear double-stranded DNA.
A: Replication: Replication is the process to copy old DNA into new DNA strands (genetic material),…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- In comparison with prokaryotes, what are some differences in the genome structure of eukaryotic cells that affect how replication takes place?Why is DNA replication is considered a semi-discontinuous process? Explain in detail.What Is The Origin Of Replication? How many are found in prokaryotes and how many are found in eukaryotes?
- With regard to DNA replication, define the term bidirectional replication.a) Under normal conditions E. coli produces three DNA polymerases. State their functional similarities and differences. b) List the other proteins and enzymes involved in DNA replication in E.coli and give their functions.Why must reoviral replication events occur within thenucleocapsid?
- Explain the following statement : a) initiation of bacteriall DNA replication is an energy requiring process b) bacterial DNA polymerase can enter the termination sequence but cannot exisWhich of the following is NOT correct concerning the initiation of replication in E. coli? Question 29 options: A) It involves a region of the DNA called oriC. B) DnaA proteins bind to the DNA to begin separation of the strands. C) The strands are initially separated at GC-rich regions of DNA. D) Following initial separation, enzymes continue to separate the parental DNA strands around the rest of the chromosome.What is meant by the description "antiparellel" regarding the two strands that make up DNA?