Testing the role of a conserved element in gene regulation (a) (b) FIGURE 14-14 A transcriptional cis-acting regulatory element is identified in an ultraconserved element of the human genome. An ultraconserved element lying near the human ISL1 gene was coupled to a reporter gene and injected into fertilized mouse 0ocytes. The regions where the gene is expressed are stained dark blue or black. (a) The reporter gene is expressed in the head and spinal cord of a transgenic mouse, as seen here on day 11.5 of gestation. This expression pattern corresponds to (b) the native pattern of expression of the mouse ISL1 gene on day 11.5 of gestation. This experiment demonstrates how functional noncoding elements can be identified by comparative genomics and tested in a model organism. [From G. Bejerono et al., "A Distal Enhancer and an Ultraconserved Exon Are Derived from a Novel Retroposon," Nature 441, 2006, 87–90, Fig. 3.]

Testing the role of a conserved element in gene regulation (a) (b) FIGURE 14-14 A transcriptional cis-acting regulatory element is identified in an ultraconserved element of the human genome. An ultraconserved element lying near the human ISL1 gene was coupled to a reporter gene and injected into fertilized mouse 0ocytes. The regions where the gene is expressed are stained dark blue or black. (a) The reporter gene is expressed in the head and spinal cord of a transgenic mouse, as seen here on day 11.5 of gestation. This expression pattern corresponds to (b) the native pattern of expression of the mouse ISL1 gene on day 11.5 of gestation. This experiment demonstrates how functional noncoding elements can be identified by comparative genomics and tested in a model organism. [From G. Bejerono et al., "A Distal Enhancer and an Ultraconserved Exon Are Derived from a Novel Retroposon," Nature 441, 2006, 87–90, Fig. 3.]

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 8P: Alternative Splicing Possibilities Suppose exon 17 were deleted from the fast skeletal muscle...

See similar textbooks

Similar questions

In this chapter you were introduced to nonsense suppressor mutations in tRNA genes. However, suppressormutations also occur in protein-coding genes. Using thetertiary structure of the β subunit of hemoglobin shownin Figure 9-3(c), explain in structural terms how a mutation could cause the loss of globin protein function. Nowexplain how a mutation at a second site in the same protein could suppress this mutation and lead to a normalor near-normal protein.
The chart below is a position specific scoring matrix (PSSM, a logarithmic transformed matrix) for a transcription factor binding site. (1). Evaluate a sequence “GACATTCA” to find out which segment of the sequence fits the binding site best. (2) What is the max score that a sequence can have with this PSSM? (3) What is the minimum score a sequence can have with this PSSM?
GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
Alignment of protein sequences from the HOX gene family identifies a highly conserved domain in the C-terminal part of the protein that is a domain (one acronym and one word). Although Hox genes have important roles during embryogenesis and tissue differentiation, the different HOX proteins bind to very similar DNA (one word) that are rich in the bases and (one word each). To ensure high affinity binding to (one acronym) and specific regulation of target (one word), the HOX proteins form complexes with (two words).
Search about transcription elongation factor P-TEFb with its relationship with CDK9 and RNA Pol II, what is the role of this particular transcription elongation factor compared with other general transcription factors and explain the mechanism on how eukaryotic transcription is controlled by the roles of this transcription factor (be specific on reaction or modification on RNA Pol II, which domain as you learn from the research article) and integrate the concept of chromatin remodeling in terms of packaging of DNA, and accessibility of the template for the RNA polymerase https://advances.sciencemag.org/content/6/50/eabc1450/tab-pdf
Transcription AttenuationHow would transcriptionof the E. coli trp operon be affected by the following manipulations of the leader region of the trp mRNA?(a) Increasing the distance (number of bases) betweenthe leader peptide gene and sequence 2(b) Increasing the distance between sequences 2 and 3(c) Removing sequence 4(d) Changing the two Trp codons in the leader peptidegene to His codons(e) Eliminating the ribosome-binding site for the genethat encodes the leader peptide(f) Changing several nucleotides in sequence 3 so thatit can base-pair with sequence 4 but not with sequence 2
Give typing answer with explanation and conclusion to all parts Consider the following DNA mRNA sequence: 5’-ACTGATCCATGCCAGGGGTTTTCAACTAAAATGAAA-3’ a) What is the template sequence this mRNA was transcribed from? Include 5’ and 3’ labels. b) Based on this sequence, what you predict would be the resulting peptide sequence from it. c) In examining this sequence what is the proper reading frame of the open reading frame? (+1, +2, +3, -1, -2, or -3). d) What would you predict the peptide sequence to be if there was the following mutation that led to a base change: 5’-ACTGATGCATGCCAGGGGTTTTCAACTAAAATGAAA-3’
A single UASG regulates the expression of threegenes, all of which are adjacent: GAL7 and GAL10 asdescribed in Problem 8, and also GAL1.a. Would you expect these genes to be transcribedinto individual transcripts, or to be cotranscribed asone mRNA? Explain.b. How could you determine experimentallywhether each gene is transcribed separately orinstead that the three are cotranscribed into asingle mRNA?c. GAL1 and GAL10 are not only adjacent to eachother, but also are transcribed divergently with asingle UASG between them. Describe experimentsusing GFP and RFP transgenes that would allowyou to determine which of the four GAL4 bindingsites in this UASG element is (are) important for thetranscription of GAL1 and/or GAL10.
Transcriptional regulation You are interested in studying the transcriptional regulation of Glp1 promoter. This gene contains a binding site for two proteins A and B. Proteins A and B cannot bind to the DNA at the same time due to steric interference caused by a slight overlap in their binding sites. The binding sites of protein A and protein B can be seen in the figure below. Protein A binds to Site C and Protein B binds to site D. To assess whether either A or B have an influence on Glp1 expression, you create mutations in the DNA that selectively remove the non-overlapping sequences of binding site C or binding site D. You then examine Glp1 mRNA production within adult liver cells. You receive the following data. Experiment number Binding site C Binding site D Glp1 mRNA levels 1 + + high 2 + - high 3 - + none 4 - - none += binding site present, -= binding site absent What does this data tell us about which protein is…
11c all three of the classes or types of eukaryotic transcriptional regulators have alpha helical structure. name any two of the three major classes of eukaryotic transcriptional regulators.
During transcription, how many RNA nucleotide bases would usually be encoded by a sequence of 99 DNA nucleotide bases? (a) 297 (b) 99 (c) 33 (d) 11 (e) answer is impossible to determine with the information given
4.1 Name and discuss two transcription regulatory elements that can be found in the figure. (6)4.2. During the activation of eukaryotic transcription the promoter region needs to be accessible for the binding of transcription factors. Describe in detail one of the mechanisms involved in this process.