Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.)   5’- TAAGCGTAACACGCTAA   CAGTAATGCAGAACT   GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT    GTCATTACGTCTTGA     CCCAGGATAAAAGCACGCATGTG -5’   Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)

Q: A circular molecule of DNA contains 1 million base pairs. If the rate of DNA synthesis at a…

A: in prokaryotes, the genomic DNA is in a circular format and adopt the theta replication model,…

Q: Below is a sample of a segment of DNA…(copy from left to right)   3’…

A: Mutation  It occurs when a DNA gene is changed in such a way as to alter the genetic message carried…

Q: a) If you isolated DNA from the ear and the tail of the same mouse, would you expect the DNA,…

A: The extraction of deoxyribonucleic acid (DNA) from diverse sources is known as deoxyribonucleic acid…

Q: At a specific area of this chromosome, the sequence of nucleotides below is present where the chain…

A: The region of DNA known as the replication fork is where the replication process itself is now…

Q: Match Column A  (Description) with Column B (protein/enzyme)

A: One new strand (the leading strand) is created as a continuous segment during DNA replication. The…

Q: Single-stranded binding proteins (SSBPs) bind to single-stranded DNA at the replication fork and…

A: A pairs with T with2 hydrogen bonds and C pairs with G with 3 hydrogen bonds.

Q: Complementary DNA strand of 5'-ATTCGTATTCCCGCGGTGCAAC-3' OA.) 5-TAAGCATAAGGGCGCCACGTTG-3' OB.) 3-…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: Is it unusual that the -subunits of DNA polymerase III that form a sliding clamp along the DNA do…

A: Replication of DNA is catalyzed by a DNA polymerase enzyme. There are many types of DNA polymerases…

Q: Why must the lagging strand of DNA be replicated in short pieces a. Because of limited space b. To…

A: The replication of the DNA takes place in a semiconservative pattern in which the DNA duplex unwinds…

Q: Which of the following statements is not true? Explain why. A. A DNA strand can serve as a template…

A: DNA is deoxyribonucleic acid. The nucleic acids are the building blocks of DNA molecules.  DNA is a…

Q: Does the addition of a histidine tag affect DNA polymerase activity and or processivity? Give a…

A: DNA polymerase is an important enzyme of dna replication and can add nucleotide triphosphates to 3’…

Q: In bacterial cells, nucleotide excision repair involves which of the following proteins? DNA…

A: The principal method utilised by mammals to remove bulky DNA lesions such as those caused by UV…

Q: is DNA replication called semiconservative?   A. Both daughter strands are entirely new B. Each…

A: Replication of DNA is very  important for the transmission of chromosomal DNA from one generation to…

Q: Suppose that a single DNA base change of an A to a T occurs and is copied during replication. Is…

A: DNA replication is necessary for the survival of the organism.

Q: Suppose that 28% of the nucleotides in a DNA molecule are deoxythymidine 5′- monophosphate, and that…

A: DNA is a double stranded helical polynucleotide. It usually consists of two helices, sequences of…

Q: 5-ccuaaucg-34 3'-acctgcctataccggattagetetgatectaagcatgte-5" The diagram above shows an RNA primer…

A: Given -  RNA primer :   B   5'-ccuaaucg-3"    C   Template strand :    A…

Q: Here are two strands of DNA. —————————————— DNA polymerase→ —————————————————————— The one on the…

A: DNA polymerases are enzymes that synthesize DNA molecules from deoxyribonucleotides (the building…

Q: (i) Indicate by drawing where the RNA of Telomerase binds to the telomeric region. W, X, Y, and Z…

A:

Q: Suppose a mutation occurs in a cell such that normal Okazaki fragments were created during DNA…

A: DNA helicase, is an enzyme that separate double-stranded DNA into single strands allowing each…

Q: Consider the following segment of DNA, which is part ofa much longer molecule constituting a…

A: Deoxyribonucleic acid, or DNA, could be a molecule that contains the directions AN organism must…

Q: In relation to central dogma of molecular biology answer the following questions: A- Give two…

A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which…

Q: a) "Out of three E.coli DNA polymerases, DNA polymerases 3 has a high processivity and rate of…

A: A DNA polymerase is a member of a family of enzymes that catalyze the synthesis of DNA molecules…

Q: DNA Polymerase Holoenzyme Il is represented below. It consists of several domains with distinct…

A: At the replication fork, DNA polymerase III holoenzyme (Pol III HE) works with the helicase and…

Q: The sequence below shows the ends of one strand of a linear chromosome, with slashes representing…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…

Q: Considering that DNA is synthesized in the 5' to 3' direction, which direction must DNA polymerase…

A: Introduction: Biological information is transferred from DNA to RNA and then to proteins. This is…

Q: Draw a molecule of DNA undergoing eukaryotic linear replication. On your drawing, identify (a)…

A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…

Q: Which DNA repair systems you think might be capable of repairing a situation where T is in one…

A: DNA repair is a process by which a cell identifies and corrects damage to the DNA molecules. Most…

Q: During DNA replication, the function of RNA primers is to  Group of answer choices serve as a…

A: DNA replication is the process by which two copies of DNA is produced from a parent DNA molecule. It…

Q: The epsilon subunit of DNA polymerase III is responsible for its _______ activity. A-5'---->3'…

A: DNA Polymerase III is an enzyme that is involved in DNA replication and synthesis. It has 3'-5'…

Q: A primer is laid down complementary to the DNA sequence TAGCAATCGCA to prime synthesis of a daughter…

A: Answer: Introduction: In living organisms, primers are short strands of RNA or DNA commonly 18-22…

Q: How is DNA copied with leading and lagging strands? Please use these terms in a summary: Helicase…

A: DNA is the molecule which comprises of two polynucleotide chains that wound around each other for…

Q: What is the function of DNA gyrase? O a prevents the two complementary template strands from bonding…

A: DNA replication is the process of formation of replica of DNA. It involves various enzymes which…

Q: In the following diagram, A and B are two Okazaki fragments generated during DNA replication. Solid…

A: During replication forks, Okazaki fragments are transient components of lagging strand DNA…

Q: elow is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA…

A: Without the enzymes, DNA replication is incomplete. The initiation, elongation, termination, and…

Q: Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA…

A: They enhance the rate of a reaction without being consumed or modified during the reaction.…

Q: Please help me with the orange question.  My answer is leading strand will encounter lagging strand.…

A: DNA replication takes place in a bidirectional mode in which both strands are replicated…

Q: The following diagram represents a DNA molecule that is undergoing replication. Draw in the strands…

A: Chromosomes are carrier of deoxyribonucleic acid (DNA). DNA is the genetic material. Each species…

Q: In bacterial cells, nucleotide excision repair involves which of the following proteins? A.    DNA…

A: DNA  A deoxyribonucleic acid polymer that present in the nucleus and carry genetic information.

Q: Match the lettered activities to the following enzymes. Remember that some enzymes have multiple…

A: DNA Polymerase III is an enzyme primarily involved with DNA replication in prokaryotes. In 1970, it…

Q: What factors promote the fidelity of replication during the synthesis of the leading strand of DNA?…

A: Factors which promote the fidelity of replication are DNA polymerase enzyme ,mismatch repair system…

Q: Assume the sequence below is one half of a double stranded DNA template used in a PCR reaction. The…

A: Primers are short sequences of single stranded polymer that mark each ends of the target sequence. 2…

Q: On a piece of paper, replicate the following segment of DNA:             5’ ATCGGCTACGTTCAC  3’…

A: DNA(deoxyribonucleic acid) is a double-stranded helical genetic material that contains thousands of…

Q: Arrange the steps in the base excision repair process. Write the capital letter corresponding each…

A: Base excision repair Base excision repair is a DNA repairment mechanism in which the incorrect…

Q: DNA repair enzymes preferentially repair mis- matched bases on the newly synthesized DNA strand,…

A: DNA repair enzymes are proteins that detect and repair physical damage to DNA induced by radiation,…

Q: Suppose that 22% of the nucleotides of a DNA molecule are deoxyadenosine and during replication the…

A: Suppose that 22% of the nucleotides of a DNA molecule are deoxyadenosine and during replication the…

Q: DnaA proteins bind to repeated binding sites on the DNA double helix, helping to recruit the…

A: Replication is the process by which a double-stranded DNA molecule is copied to produce two…

Q: If you have got the following DNA template molecules, which one of them will require more energy to…

A: DNA is made out of four unique sorts of nucleotides, in particular, adenine, thymine, cytosine, and…

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.