Specificity is defined as: A. False positive rate of a test. B. True negative rate of a test. C. False negative rate of a test. D. True positive rate of a test.
Q: What is the function of the alcohol in the extraction of DNA? What is the property/characteristics…
A: DNA extraction involves different steps which include, the breaking of cells to open and…
Q: Imagine a disease that involves reduced expression of receptor X. There is no concentration of full…
A: In receptor-ligand interaction, the receptor is a macromolecule that serves as the binding site of…
Q: Mnemonic about the UREA CYCLE that is not from the internet. Thank you.
A: Urea cycle is also known as the Ornithine cycle. In urea cycle urea is produced from ammonia. Urea…
Q: Which test can you use to distinguish a monosaccharide from a disaccharide? hexoses from pentoses?…
A: Any of the fundamental substances that form the basis of carbohydrates are referred to as simple…
Q: Give the isoelectric points of following 2 tripeptides DRI and RID.
A: pI (isoelectric point) of an amino acid is the PH at which the amino acid carries zero net charge. A…
Q: The value of kcat for N-Ac-Phe-OC₂H5 is two-fold greater than that for the L-tryptophanyl analog and…
A: Chymotrypsin catalyzed peptide bond hydrolysis takes place in 2 phases after the enzyme binds the…
Q: What is most correct about the following inhibition? Penicillin
A: The antibiotic penicillin irreversibly binds to and inhibits the activity of the transpeptidase…
Q: Determine the chemical formula for the following molecules by counting the Carbon, Hydrogen and…
A: Introduction : Carbohydrates - Also known as carbs, are sugar molecules which consists of…
Q: 8. Why is it important to maintain blood glucose during exercise? How is this achieved?
A: During exercise, it is important to maintain glucose homeostasis. There is a tight regulatory…
Q: I. Data A. Solubility in water Sample alanine glutamic acid arginine albumin B. Color Reactions of…
A: Amino acids are building blocks of proteins while proteins are polymers of amino acids. The…
Q: 018 You have isolated a gene that spans a total of 1800 nucleotides. The gene contains 400…
A: Genes are the sequences of nucleotides attached together through phosphodiester bonds. Genes are…
Q: fredrickson's classification of hyperlipidemia (tubular format)
A: Familial hypercholesterolemia (FH) has an HLP2A (Frederickson type IIa) lipid profile. Fredrickson…
Q: How to calculate percentages of arginine have positively charge at PH=7
A: pH is the measure of H+ ion concentration ( denoted by [H+]) in the solution. High pH means low H+…
Q: All are single-electron carriers EXCEPT: a. UQH2. b. Cyt bL. c. Cyt bH. d. Rieske protein…
A: The process electron transport chain requires four different complexes that are situated in the…
Q: Select the correct response:
A: Tyrosine gives rise to catecholamines which includes dopamine, norepinephrine, and epinephrine.
Q: Bacteria and other prokaryotic cells have the capacity to get more ATP/glucose oxidized than…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: How to calculate percentages of arginine 's side chain have positively charge at PH=7
A: INTRODUCTION: Arginine : It is an amino acid with the chemical formula CN(CH2)3CHCO2H. Its molecule…
Q: What is acid-base homeostasis?
A: Homeostasis is the ability of an organism to regulate its internal environment in varying external…
Q: 13. Linear regression analysis was performed for the calibration standard data set based on this…
A: Concentration of any unknown sample can be found out from a standard curve. The standard curve is…
Q: Write the schematic diagram of lodine Value Determination as shown in the video by Amrita Vlab:
A: Simple fats are triglycerides. Triglycerides or triacylglycerols are fatty acid esters of glycerol.…
Q: 1) Which of the following statement(s) regarding the ends of polysaccharides are true? All…
A: The biological macromolecules can be classified as proteins, nucleic acids, lipids and…
Q: a) Draw the A-T and G-C base pairs. - Label the bases…
A: DNA are polymers of nucleotides. A nucleotide consists of a nitrogenous base(A, T, G, C) attached to…
Q: Identify the type of chemical reaction. 1 R R 2 Fat / Oil C01695 -R 3 NaOH/H₂O heat Lye Linoleic…
A: Triglycerides are fatty acid esters of glycerols. Fatty acids are carboxylic acids with a long…
Q: Use the data below to answer the following question: How much more energy is stored in a gram of fat…
A: A heterogeneous class of substances with comparatively similar physical characteristics are referred…
Q: 3. DNA: TACGGGCCTATACGCTACTAC TCATGGATCGG mRNA: Codon: Anitcodon: Amino Acids:
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: what element is this? after MDA reacts with something Ph CH3 N CH3
A: MDA is malondialdehyde . It is a product of lipid peroxidation in corals. Determination of this MDA…
Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…
A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…
Q: Beer's Law to determine Protein Concentration You have purified a recombinant form of the p53…
A: The determination of protein concentration is necessary for diverse biochemical experiments. The…
Q: Describe two different ways in which glucose oxidase is regulated. These mechanisms of regulation do…
A: Glucose oxidase: It is an oxidoreductase that catalyzes the conversion of glucose to hydrogen…
Q: It is obtained from the milky secretion of various plants such as the tree Hevea brasiliensis.…
A: Hevea brasiliensis, the Para rubber tree, or most commonly, rubber tree or rubber plant, is a flower…
Q: Place the following enzymes in the correct order of action RNA 5' triphosphatase RNA polymerase II…
A: The newly synthesised mRNA is called the primary transcript. Before the primary transcript can be…
Q: The main stages of catabolism of biomolecules: proteins, carbohydrates and lipids.
A: Catabolism is one is the steps of metabolism in which complex compounds are hydrolysed into simpler…
Q: Dehydrogenase reactions in TCA cycle
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by oxidation of…
Q: Adding a glucose unit to the growing glycogen chain O Requires the production of 1 ATP molecule O…
A: After a meal, there is a surplus supply of glucose in the blood. this causes the pancreas to secrete…
Q: 6.) Calculate the concentration (N) of arsenic acid (H3A504) in a solution if 25mL of that solution…
A: Given that, Volume of 0.1894 molar KOH required to neutralize anseric acid is 35.21 mL. Volume of…
Q: Chemistry When the steady-state concentration of a drug on one side of the membrane is 5 micromolar…
A: According to Fick's first law, dC/dt= K(C1-C2)/h
Q: Water-soluble proteins such as myoglobin tend to fold such that: OA) hydrophobic amino acids…
A: Myoglobin, a globular protein, contains a single polypeptide chain of 153 amino acid residues and a…
Q: The second high energy intermediate metabolite of glycolysis that can be used for substrate level…
A: Glycolysis is the biochemical pathway by which six-carbon glucose is converted to three-carbon…
Q: Name the three major types of membrane lipids in animal cells and provide a specific example of…
A: The cell membrane is composed of lipids and proteins. A small amount of carbohydrates is also…
Q: Indicate whether the following pairs of monosaccharides are aldoses or ketoses. a. D-altrose &…
A: INTRODUCTION : Monosaccharides : They are also known as simple sugar. They are the simplest forms of…
Q: Why are single strand binding proteins (ssb proteins) needed in DNA replication? (note that you need…
A: DNA consists of two strands of polynucleotide that are linked to each other via hydrogen bonding…
Q: H K Br Br H trans-2,3-dibromo-2-butene cis-1,2-dibromoethene Otrans-1,2-dibromoethene…
A: The structure given the question represents- Answer- trans - 1,2- dibromoethene
Q: Which of the following statements about protein folding is incorrect? Select all. GroEL/GroES allow…
A: The proteins fold into their proper three dimensional structure in order to be biologically active.…
Q: Under aerobic conditions of high ratios of NADH/NAD+ and ATP/ADP, as pyruvate is utilized for its…
A: Pyruvate under Aerobic conditions: Pyruvate can diffuse into mitochondria under aerobic conditions,…
Q: 5. State whether the following statements are True or False, If False, explain why 5.1 Oxaloacetate…
A: 1. Oxaloacetate is formed by the oxidation of L-malate - Oxaloacetate is formed via oxidation of…
Q: Fumerase is an enzyme in the citric acid cycle that catalyzes the conversion of fumerate to…
A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…
Q: Why is Hopkin's Cole test specific for tryptophan?
A: There are are biochemical tests that can be used for the detection of proteins and amino acids in a…
Q: Discuss how to determine the elements of proteins and its reactions.
A: Proteins are the most abundant biomacromolecule of life. Proteins are primarily polypeptide…
Q: Problem 1: Calculate the hydrolysis of ATP at pH 7 at 37°C under steady state conditions in which…
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration of…
Q: Experiment 1.2 - Reaction over time 2. Using the standard curve in 1.1, calculate the amount of…
A: The given graph is representing the relation between the absorbance of Product and the concentration…
Step by step
Solved in 2 steps
- Question 87 Match the following terms to the correct example. Question 87 options: Random sampling Blinding (person delivering intervention) Blinding (participant) Blinding (outcome assessor) 1. Study participants receive a medicated cream in a tube labelled “Cream A” or “Cream B” 2. Research assistants collect pain scores from nursing documentation flow sheets 3. Collaborative BScN students are assigned a number. 100 numbers are drawn out of a hat and those BScN students become part of the study 4. Nurses administer medication to study participants labelled “Medication A” or “Medication B”QUESTION 1 Match each description to the correct study design. Study designs may be used more than once. ◆ Incidence data is not available with this study design, so an odds ratio is an appropriate measure of association to calculate. ◆ This study design allows for the evaluation of multiple outcomes. ◆ The temporal sequence between the exposure and outcome is clear for this study design; therefore, incidence data is available and a risk ratio can be calculated. ◆ With this study design, exposure status is assessed, and then participants are followed up over time to see who develops the outcome. ◆ Recall bias is a common issue with this study design because exposure information is collected from the past. QUESTION 2 A. Cohort study B. Case-control study Consider the following scenario for the questions that follow. In a recent case-control study, investigators enrolled 300 adults with heart disease and 300 healthy adults. During interviews with the participants, the investigators…Which of the following will not come under fault diagnosis? a. Dynamic Testing O b. Replacement O c. Half split technique O d. Physical Testing
- Quèstion 3 Match each healthcare job with the type of service it provides. Answers will be used more than once. v medical assistant optician vhuman resources mânager A. health informatics |diagnostic coding specialist v central services technician |X-ray technician v pharmacist paramedic v dietitian v medical clerical worker B. therapeutic services C. diagnostic services D. therapeutic services E. health informatics F. support services G. diagnostic services H. therapeutic services I. support services J. health informaticsFamily is: Mom (32), Dad(35), ten year old son, six year old son and a dog named marlin. I am doing this paper on the effects of diabetes in this family. I need a Family health history diagram.a. Three Complete Generations (include copy of diagram in paper).b. Completed history pages (include copy of chart in paper).4. Nursing Interpretation b. What do the found results mean to the registered nurse?c. What education needs to occur for this patient?d. What is the patient at risk for (medical diagnoses)?QUESTION 7 Match the example with the type of decision-making: v A clinician explains the nature of the patient's illness, outlines the A. Shared-decision making. potential treatments, and explains the positive and negative feature of each potential treatment but does not make a recommendation. B. Informed decision making-informed consent c. Inform of decision v A clinician recommends surgery and discussed with the patient the steps that will occur as well as the potential harms and benefits. He then asks the patient to sign permission to perform surgery. v A clinician draws blood to determine whether or not a patient has diabetes but decides not to worry the patient with the results unless his or her blood sugar level is elevated.
- Question 40 Intention to treat analysis is done to determine if there are differences between the intervention group and control group related to: Question 40 options: Blinding Allocation Randomization Dropout rateA pediatrician prescribes amoxicillin for a child who weighs 33 pounds. The recommended dose is 20 mg/kg/day, and it's to be administered in three divided doses. The amoxicillin suspension available has a concentration of 250 mg/5 mL.a. How many mg per dose should the child receive?b. How many mL per dose will you administer?Screening test A as a sensitivity of 78% and a specificity of 85%. Screening test B has a sensitivity of 85% and a specificity of 90%. Given that they are applied to the same population and the same disease, which of the following statement is correct? Screening test A has a higher yield than Screening test B Screening test A is more valid than Screening test B Screening test B has better predictability than Screening test A Screening test B is more valid than Screening test A Screening test A has better predictability than Screening test B
- (J) please answer asap... Question 21 Medicare Part B covers A. in-patient costs B. out-patient costs C. specialty care costs D. prescription drug costs Question 22 Medicare Part B covers A. 100% of covered costs B. 60% of covered costs C. 80% of covered costs D. 50% of covered costs Question 23 Medicare Part D covers A. in-patient costs B. out-patient costs C. specialty care costs D. prescription drug costs Question 24 The 'donut hole' refers to A. in-patient costs B. out-patient costs C. specially care costs D. prescription drug costs Question 25 In the future of health care there will be more managed care to control costs A. TrueB. FalseChoose the correct one. The statute of limitations timing can begina. on the day the negligent act took place.b. the first day in a series of medical treatments.c. the first day of consulting with a lawyer.d. a month after the injury was discovered.Many U.S. Surveillance systems, like the Behavioral Risk Factor Surveillance System, use a serial cross-sectional study design. O Truc O Falso