SARS E You have generated several random mutations in this region. One of them is - 5'-AAUUACCUAUAGAUUGUUU-3' What may be the mutant protein sequence Enter the single letter code for the amino acids. For a stop codon (if any) enter: STOP And fill subsequent blanks with: N/A For example: if you the sequence you need to enter is: M*, enter M N/A N/A N/A N/A *
Q: The fibronectin protein has a tripeptide segment with the sequence RGD, which is important in…
A: A peptide motif is a specific sequence of amino acids within a protein or peptide that serves as a…
Q: IN PROTIEN WHICH HAS a+B STRUCURE: O a. a AND BARE ARRANGED RANDOMLY O b. NO NASWER IS CORRECT Oc.…
A: Proteins, essential players in biological processes, have structures intricately linked to their…
Q: predators that devour their prey, how does their digestive tract function to digest the food?…
A: Prеdators with a carnivorous diеt typically havе spеcializеd digеstivе systеms dеsignеd for…
Q: During your experiment you analysed only a few of the recombinant clones for the presence of…
A: The objective of the question is to understand how to construct a probe for nucleic acid…
Q: 5. (8 points) In a species of grain, the allele for round grains (G) is completely dominant over the…
A: Understanding the inheritance patterns of genetic traits can help one better understand the…
Q: 10. Albinism in maize results from a complete defect in chlorophyll synthesis and is a lethal trait,…
A: Mendel’s laws of inheritance apply to sexually reproducing eukaryotic organisms. Mendel proposed the…
Q: hypersensitivity reactions
A: Responses to antigens that result in exaggerated immune reactions, leading to tissue damage or other…
Q: Identify the sense organs and adaptive structures used by the following vertebrates by completing…
A: Vertebrates show exceptional adaptations in their sensory organs to see and interact with their…
Q: B A- E- A U D E ✓ B ✓ F- vi G- H F G D- ✓ H-
A: The image is of brain and its different parts. Brain is the most important regulatory organ of the…
Q: 1. (8 points) This figure summarizes the transport of various substances across biological…
A: The correct matches can be identified as follows-1. Passive transport - A2. Pump protein - G3.…
Q: Sleepy the Emoji was always self-conscious of her closed eyes and she fell in love with a handsome…
A: Genotype refers to the genetic makeup of an organism, while phenotype refers to the observable…
Q: Using the base pairing rules which three rna bases pair with the following dna codon TAC
A: The two nucleic acids, DNA and RNA, present in the cell are polymers made up of nucleotides. These…
Q: Limbic System, Emotion, Reward, and Addiction Describe how stimuli gain emotional significance…
A: Welcome to the fascinating world inside our heads, where the limbic system takes center stage. This…
Q: Introduction to Neuroscience College Level). Describe the synaptic and molecular mechanisms of…
A: A cellular mechanism for learning and memory, long-term potentiation (LTP) is the steady…
Q: Match the term with the correct description. A Type IV hypersensitivity response mediated by…
A: The immune system is a complex organization of specific cells, tissues, and organs cooperating to…
Q: Members of which of the following classes are endothermic, amnionic tetrapods? --all of the classes…
A: Endothermic creatures are those which are able to regulate the temperature of their bodies. They…
Q: QUESTION 4 Lemurs Monophyly (Simiformes) Paraphyly (Prosimi) Polyphyly New world Old world Lorises…
A: In phylogenetic studies, life forms are gathered into categories known as taxa. These groupings…
Q: Match the term in column 2 (A-G) with its definition in column 1. DOD Cloning vector Genome editing…
A: In the molecular biology, various techniques empower scientists to unravel the mysteries encoded…
Q: Which tissue would likely contain the least amount of carbohydrate? A) A crab shell B) A…
A: Carbohydrates are organic compounds that comprise of carbon, hydrogen, and oxygen, and they serve as…
Q: An allele causes homozygous individuals to die before birth. The allele is continuously being…
A: Inbreeding, the mating of closely related individuals, can have a significant impact on the fitness…
Q: Please fill in the blank in the picture, thank you
A: Skeletal muscles are characterized by their voluntary nature. These are striated muscles that are…
Q: ased on the NCBI blast below Are there any pathogenic missense mutations in the human gene FGFR3?…
A: Thе providеd NCBI BLAST rеsults show a comparison bеtwееn thе fibroblast growth factor rеcеptor 3…
Q: Solution : 3.3 3.2.1 Optional. If you can solve it, thank you
A: NOTE: Since it has been mentioned by the student that answer is required for 3.3. Therefore, we will…
Q: 8. What is the result of a decreased amount of antidiuretic hormone being released? a. Decreased…
A: Endocrine system:It is a control system of ductless glands that secrete chemical messengers called…
Q: Which part of the neuron provides insulation for the neurons, to prevent the loss of charged ions…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: Which of the following represents bi-substrate mode of enzyme substrate binding? O Lock-and-Key…
A: Enzyme-substrate binding is an important step in enzymatic processes.The Lock-and-Key paradigm…
Q: What are the diets that each of the types of digestive system cater to?
A: The digestive system is a complex set of organs and processes that breaks down food into nutrients…
Q: What is the mRNA strand of the following DNA (coding) strand: ATGGCTAACCTTGTA
A: Gene expression is the process through which data from a gene is employed in the synthesis of a…
Q: When cut with Hind III, what size should our GFP fragment be on the gel? Amp-R PGLO Plasmid 5371 bp…
A: When we cut the plasmid with HindIII, a GFP fragment of about 730 bp will be formed.
Q: How will this look drawn in?
A: Glycolysis, pyruvate oxidation, citric acid cycle, electron transport chain, chemiosmosis are…
Q: Q5.7. If you removed all the Lions from a large area of savanna, which of the following is an…
A: In a savanna ecosystem, the relationship between lions and gazelles is a classic example of a…
Q: For this pedigree, assume all individuals are homoplasmic, but people from different families have…
A: Mitochondrial DNA (mt DNA) is a circular chromosome found inside mitochondria. Unlike nuclear DNA,…
Q: PREDATION After being stung by too many scorpions, you decide to shift your research focus to a…
A: Drawing thе statе spacе isoclinеs for a prеdator-prеy systеm involvеs undеrstanding thе еquilibrium…
Q: 4. a. What is the abbreviated name for the molecule below? (3 letters) What is the abbreviated name…
A: NOTE: Since you have posted questions with multiple sub parts, we will be solving the first three…
Q: Summarize global climate change section and give examples.
A: Global Climate ChangeGlobal climate change is long-term changes that happen in Earth's climate.…
Q: Question 19 Purkinje cells typically fire more than 50 action potentials (simple spikes) per second…
A: Purkinje cells and granule cells, two distinct neuron types in the cerebellum responsible for motor…
Q: man, assume that spotted skin (S) is dominant over non-spotted skin (s) and that wooly hair (W) is…
A: In the realm of genetics, understanding the interplay of dominant and recessive alleles is crucial…
Q: Consider a different mutant allele in gene V (allele ID: v4). Interestingly, many (but * not all)…
A: The vulva in C. elegans is a model system for studying cell differentiation and organogenesis. Its…
Q: Highlight each peptide bond in the molecule below. In addition, list the common names of the smaller…
A: Peptide bonds are the chemical bonds that link amino acids together in a polypeptide chain, forming…
Q: Which of the following regarding GPCR's is FALSE?
A: GPCR is also known as G protein coupled receptor. It is an integral membrane protein that contains…
Q: Please give me long detailed answer
A: Constitutive heterochromatin refers to regions of the genome that are consistently condensed and…
Q: Mina is a 35-year-old woman in a monogamous, long-term relationship. She and her partner have just…
A: Contraception, additionally referred to as birth control, describes the methods and technologies…
Q: t is a warm, summer day and you are out for a walk. Suddenly, you hear a dog bark. You turn, and see…
A: In response to the stimulus of hearing a dog bark and seeing a dog running toward you, your body…
Q: Several generations of population X have been studied. The dominant phenotype frequency for the…
A: Evolution is the shift over successive generations in the heritable traits of biological…
Q: Protein phosphorylation is reversible due to actions of the enzyme ______. --Phosphatase --ATP…
A: Protein phosphorylation-It is a post-translational modification. In this process, a phosphate group…
Q: In an alien population on Mars the individuals were assessed for the following traits (p and q…
A: Selection is the process by which certain individuals in a population are more likely to survive…
Q: A couple with the following blood types: the man has type AB and the woman has type B, discover…
A: The blood grouping system is seen as per the rule of multiple alleles and co-dominance. It is given…
Q: Which is the most correct order of the theorized evolution of life on Earth?
A: The term "evolution" refers to the process of change in all forms of life over generations. The…
Q: Which is NOT correct about HPV? It establishes life long latency in the sensory neuron ganglia It is…
A: The question is asking us to identify the incorrect statement about Human Papillomavirus (HPV).
Q: Limbic System, Emotion, Reward, and Addiction Review the anatomy and function of the hypothalamus…
A: The Papez circuit, also known as the limbic circuit, is a neural pathway in the brain that was…
Step by step
Solved in 3 steps
- Suppose that a protein has the amino acid sequence Met‑Tyr‑Asn‑Val‑Arg‑Val‑Tyr‑Lys‑Ala‑Lys‑Trp‑Leu‑Ile‑His‑Thr‑Pro A researcher plans to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Her probes should be exactly 18 nucleotides in length. Consult the codon table. Select which amino acids in the protein should be used to minimize degeneracy when designing the probes. Val‑Tyr‑Lys‑Ala‑Lys‑Trp Met‑Tyr‑Asn‑Val‑Arg‑Val Arg‑Val‑Tyr‑Lys‑Ala‑Ly Trp‑Leu‑Ile‑His‑Thr‑Pro Calculate the number of different probes that must be synthesized in order to determine the exact cDNA sequence that specifies the region of the protein selected. number of probes:5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this geneWrite the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC GCG CGG UAA-3'
- Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…The DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
- For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG GOn the space provided, type the translation product of wild-type gene A (use three- letter abbreviation for the amino acids; use - to indicate a peptide bond). 5' CTAATCGCCTAATCCGCTTGCGGCCAT 3'Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
- Determine the amino acid sequence for a polypeptide coded for by the following mRNA transcript (written 5'-> 3'): AUGCCUGACUUUAAGUAGGiven the following genomic sequence which contains 2 exons and CDNA sequence predidt the amino acid sequence of the exons which are part of the coding region of a protein. How many nucleotides make up the intron? Second letter UAU TV UACJ UAA Stop|UGA Stop A UAG Stop UG Trp UUU1 Phe UUCJ UGU1, UGCJ UCU) Cys UCC Ser UCA ULA UCG CUUT CUC CUA CUG CCU CAUT C4C His CAAT CAGJ OGU CCC Leu CA CGC FArg CGA Gln CGG Pro CCG AUU AUC lle AUA ACU AGU AAU AACJ AAA 1 AAGYS Asn Ser ACC Thr ACA AGC. AGA Arg AUG Mer ACG, AGG GCU GAUT GACJ GGU GGC GUU Asp GUC Val GUA Gly Ala GAA Glu GAGJ GGA GGG GUG GCG G. Genomic antisense sequence: 5'-TAACTGATTCTAGGCTACTCTTTCACCTAA-3" CDNA sequence: 5'-TAACTGATTTCTTTCACCTAA-3" I Use the editor to format your answer First letter 皇 Third lettermRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…