Question 4 Listen Which of the following have not been proven to have been cloned as whole organisms? (You might have to do some research) a) Primates b) Humans c) Frogs d) Horses e) Cats
Q: In winter, in cold temperate lakes, the warmest water usually occurs: Group of answer choices at…
A: The question is asking about the distribution of temperature in a cold temperate lake during winter.…
Q: In cats, there is a coat color gene located on the X chromosome which has two alleles—an allele for…
A: Answer well explained above.
Q: An example of a sustainable agriculture practice is _______. a. widespread use of…
A: The objective of the question is to identify which of the given options represents a sustainable…
Q: Black men are more likely to get prostate cancer than other men. You are working on a prostate…
A: The objective of the question is to understand the various procedures involved in a prostate cancer…
Q: A child with Type O blood is born to a mother with Type B blood. What is the genotype of the child?…
A: The child has type O blood because they inherit two "O" genes, one from each parent. The mother has…
Q: Below is an EMSA showing four different reactions, A-D. In each tube there is some combination of…
A: Reaction A: Protein X only. No DNA probe or antibody present. This is inferred because there is no…
Q: make a pathophysiology flow chart of Upper Respiratory Tract Infection with a data of: 3 months old…
A: The objective of the question is to create a pathophysiology flow chart for an Upper Respiratory…
Q: Pierre Simon de Laplace claimed that all of the following planets in our solar system are older than…
A: According to Pierre Simon de Laplace's theory, Mercury is the youngest planet in our solar system.…
Q: Gakg614 micro Mail-Kayli J Google Docs x <fo × Xavier Univer…
A: Approach to solving the question: Detailed explanation: Examples: Key references: Health Science
Q: What are the estimated populations in the Artic for the following marine mammals that are Species of…
A: The estimated populations of the specified marine mammals in the Arctic are given below: Polar…
Q: Urgently needed
A: A) Allele FrequenciesTotal Rabbits (N) = 150Homozygous Dominant (WW) = 100Heterozygous (Ww) =…
Q: The signature tool of the Acheulean tool industry is the tear-drop shaped handaxe, an all purpose…
A: The question is asking whether the tear-drop shaped handaxe, which is associated with the Acheulean…
Q: step by step calculations please
A: For the first column:Concentration = 180 ng/ulVolume = 25 - 0.4 ul = 24.6 ulng DNA = 180*24.6 =…
Q: Question 18 What is the function of the CRISPR-Cas system in nature? O part of the bacterial immune…
A: Detailed explanation: Option 1 is CORRECT because the natural function of the bacteria's CRISPR-Cas…
Q: Which of the following statements about heterochromatin is FALSE? It contains…
A: The false statement from the given choices is:Histone proteins in heterochromatin are heavily…
Q: Describe the major evolutionary advancements that took place among the australapiths and the early…
A: I hope these suggestions and recommendations help you with your assigned tasks. To further…
Q: 1. What is an example of an ADL? Cooking Cleaning Toileting Managing money
A: Introduction to Activities of Daily Living (ADLs)Activities of Daily Living (ADLs) refer to routine…
Q: What is the simplest way to solve this? Please give me a step by step explanation.
A: Approach to solving the question:Detailed explanation: Note: 10×10−2=101−2=10−1…
Q: Anne recovers from smallpox. Is Anne likely to get sick if she is infected with the smallpox virus…
A: The question is asking whether Anne, who has recovered from smallpox, is likely to get sick again if…
Q: Humans have a complex relationship with fresh water and having too much or too little can be deadly.…
A: The objective of the question is to understand how human populations respond to extreme water…
Q: The following image is a scheme for serial dilutions prepared for spectrophotometric analysis. If…
A: Step 1:Step 2:Step 3:Step 4:Step 5:
Q: Hydrolysis of a polysaccharide is accompanied by order. AG and negative increased zero unpredicted…
A: This is because the hydrolysis of polysaccharides, like the breakdown of starch or cellulose into…
Q: Describe the action potential conduction and neurotransmission process from one neuron to another,…
A: Chemical Transmission (Neurotransmission):The connections between neurons, or synapses, are where…
Q: Case 1: In late August, a woman brought her 11 year old son, Michael, to their family physician…
A: Approach to solving the question: Detailed explanation: Examples: Key references: Health Science
Q: Key: #= carnivorous tetrapods ~= herbivorous invertebrates * = plants and fungi A = terrestrial…
A: Here's the order of fossils appearing from bottom to top in core D:Terrestrial cyanobacteria…
Q: Pick a theory/concept involving biomechanics and discuss how you can apply it when having a job as a…
A: a) Which biomechanical theory is used?In the realm of physical therapy, one of the foundational…
Q: write the importance of plant-associated microbiome in plant health and growth of…
A: The plant-associated microbiome plays a crucial role in plant health and growth. These…
Q: Meiosis:
A: MEIOSISBEFORE MEIOSISInterphaseDNA is replicatedMEIOSIS IProphase ISynapses occurs; crossing over…
Q: Evaluating the positive and negative effects stress has on the human body 1. Does stress affect…
A: Approach to solving the question:Explained the queries on does stress affect reflexes and did based…
Q: Urgently needed
A: A) In conditions of low tryptophan abundance, the trp operon will not be repressed by the trp…
Q: Large ground finches on Daphne major only occasional disperse to and from other subpopulations on…
A: Dispersal refers to the process involving the movement of an individual or multiple individuals away…
Q: what does it mean if a ratio is 1.5
A: A ratio is a way of comparing two or more quantities. It is a mathematical expression that…
Q: Questions are in the image
A: 1) Human Growth Hormone (HGH) is a hormone produced by the pituitary gland that plays an important…
Q: Can you please give a basic information on Sertraline?
A: Sertraline is a type of medication known as a selective serotonin reuptake inhibitor (SSRI). It's…
Q: Fraction of Age Individuals surviving RS of survivor RS of survivor carrying A, allele carrying A₂…
A: The question is asking for the interpretation of a table that represents the survival and…
Q: Using your worksheet above, determine the sex for pelvis 2A: female 1.Describe two pelvic sexing…
A: PLEASE SEE HERE;Here is the guided explanation; you can tailor it and add your own insights. The…
Q: 5. What tip should be used when assisting a person with Alzheimer’s disease with eating? Know the…
A: Detailed explanation:When aiding people with Alzheimer's disease during mealtimes, it is critical to…
Q: make sure it’s correct i need asap
A: To graph the data and identify survivorship type, possible density-dependent factors, and…
Q: 2. What is the best way to approach toileting with persons with Alzheimer’s disease? Upon request…
A: Proactive:Observe their routine: Look for signs they might need to use the restroom, like…
Q: Urgently needed
A: The correct answer to the question regarding the technical advancement that allowed the products of…
Q: . List the parts of the light reactions that are proteins. List the parts of the light reactions…
A: Step 1:Photosynthesis is a process in which plants, algae, and some bacteria convert sunlight,…
Q: State the percentage range of the fresh weight of animals that is made up of water, and situate…
A: The objective of the question is to understand the percentage of water that makes up the fresh…
Q: Urgently needed
A: To answer your questions, we first need to determine the Open Reading Frame (ORF) from the provided…
Q: Paleoanthropologists generally agree that Homo erectus belongs in our genus and represents a…
A: Approach to solving the question: H. habilis: More Like Australopithecus or Homo? Given its smaller…
Q: Calculate the pH of the resulting solution if 23.0 mL of 0.230 M HCl(aq) is added to 33.0 mL of…
A:
Q: Urgently needed
A: Answer well explained above.
Q: Why is transmission of cytomegalovirus (CMV) through blood components not a significant risk to most…
A: The objective of the question is to understand why the transmission of cytomegalovirus (CMV) through…
Q: Forensics Q1
A: In this scenario, the DNA gel analysis reveals genetic markers that are shared between both the wife…
Q: Why is intelligent design (ID) a flawed argument? Select the statement that is FALSE. There is no…
A: The concept of irreducible complexity in Intelligent Design is misrepresented in this statement.…
Q: Select a theory or concept from biomechanics and discuss how you can apply it when having a job as a…
A: Joint Mobilization and Physical Therapya) Biomechanical Theory: Joint MobilizationJoint mobilization…
Genetics Q4
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- Question one: PCR You want to amplify the underlined sequence, 1) Design Forward and Reverse primers to do so 2) Calculate the melting temperature for them 3) Calculate annealing temperature for them 4) Do you think your primers are high quality (Length, differences in melting between R and F, possibility of forming hairpins)? GTGTGCTGGTTATTCAAACAGATAAAAAAATTAAT CTATATGGTAATGCTCTAAGCCGCGCAAATACAG AATATGTGCCAGCCTCTACATTTAAAATGTTGAAT GCCCTGATCGGATTGGAGAACCAGAAAACGGATA TTAATGAAATATTTAAATGGAAGGGCGAGAAAAG GTCATTTACCGCTTGGGAAAAAGACATGAСАСТА GGAGAAGCCATGAAGCTTTCTGCAGTOCCCAGTCT ATCAGGAACTTGCGCGACGTATCGGTCTTGATCT CATGCAAAAAGAAGTAAAACGTATTGGTTTCGGTA ATGCTGAAATTGGACAGCAGGTTGATAATTTCTG GTTGGTAGGACCATTAAAGGTTACGCCTATTCAA GAGGTAGAGTTTGTTTCCCAATTAGCACATACACA GCTTCCATTTAGTGAAAAAGTGCAGGCTAATGTAA AAAATATGCTTCTTTTAGAAGAGAGTAATGGCTAC AAAATTTTTGGAAAGACTGGTTGGGCAATGGATAT AAAACCACAAGTGGGCTGGTTGACCGGCTGGGTT GAGQuestion 43 The addition of restriction endonucleases in the cloning process is done following the ligation with DNA ligase. A) True B) FalseQuestion 6 Plasmids that generate blunt ends after restriction enzyme digestion are the ones most effective for recombinant DNA technology. A True B) False
- Question 3 PUC plasmids are widely used because of the beta-lactamase gene that renders an easier blue and white screening process in transformant selection. (A) True B) FalseQuestion 3Which of the following statements regarding conjugation pili is correct? Question 3 options: a) They facilitate the transfer of RNA between bacterial cells b) They contribute to antibiotic resistance c) They are involved in sexual reproduction d) They are longer than fimbriae and flagellaQUESTION 1 You want to perform PCR on the CDNA of the spike gene from a SARS CoV-2 sample so that you can sequence it. Based on the sequence below, which of the following primer pairs would probably work for PCR of this gene? Spike gene Sequence: 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGGTT TACTATCCTGATGAAATTTT. .. (it's really long so didn't post the whole thing.).TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTG ATGAGGATGACTCTGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC - 3' (Tm = 60.5 °C in a standard qPCR mix) Reverse Primer: 5' GGG TGT CAA ATT ACA TTA CAC ATA - 3' (Tm= 59.6 °C in a standard QPCR mix) Forward Primer: 5'- ATG TTT ATT TTC TTA TTA TT -3' (Tm=D 47.2 °C in a standard qPCR mix) Reverse Primer: 5'- GCA AGA ACC ACA AGA GCA TGC ACC -3' (Tm= 68 °C in a standard qPCR mix) Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC -3'…
- Question 49 The Sanger method of DNA sequencing follows the principle of complementarity just like in the replication process. A) True B) FalseQuestion 14 If Guanine is 30% of the total bases in a dsDNA, the thymine content is 40%. A) True B) FalseQuestion 2 The discovery of the DNA structure started the modern era of biotechnology. A) True B False
- Question #3: CRISPR has been used to cure an individual from sickle cell. Below is a Sanger electropherogram of a sequence from a patient without sickle cell and one with sickle cell. Sequence from a normal individual mmmm Sequence from the diseased individual G T GIIC A GC A Se SCIENCEphe A G A SCIENCE SCIENCEphoto G a) Where is the change in the sequence and what is the consequence to the protein sequence of this mutation? b) Below is an image of the normal and diseased quaternary hemoglobin protein. What is different about the protein shape and why does that structure have a huge impact on its function (please name the function!)? Adult haemogBRAR G G G G A G Sickle Cell haemoglobin S Structure a s RARY COLIBRARY c) If you were to use CRISPR to modify the genome of a diseased individual, to which nucleotides might you design your guide RNA? Why? d) RNA Seq is used to determine off-target effects of Cas9 cleavage. Why is this an appropriate tool to determine these effects? e) Data on…Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting factors) Question: What are controversies or ethical dilemmas surrounding this genetic technology or process?QUESTION 6 To verify the is indeed inside your plasmid, you'd like to do a colony PCR. But you need primers for your reaction. Which of the following primer pairs would probably work for verifying your insert is actually present in the plasmid? 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGG TTTACTATCCTGATGAAATTTT (Very long, but a bunch of nucleotides her e).... TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTGATGAGGATGACTC TGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm= 59.8 O A. Reverse: 5' CAA ATT ACA TTA CAC ATA A 3' Tm= 47.4 Forward: 5' ATG TTT ATT TTC TTA TTA TTT 3' Tm= 47.1 C O B. Reverse: 5' TAT GTG TAA TGT AAT TTG ACA CCC 3' Tm3 58.4 Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm3 59.8 OC. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG 3' Tm: 59.4 Forward: 5' GGT CAC TAC CAC TAG TGA GAG 3' 59.4 C O D. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG…