QUESTION 3 Shown here is a DNA sequence. The promoter is highlighted in yellow and the terminator is highlighted in blue. Transcription begins 10 bases from the promoter. What are the first 4 amino acids in this protein? 5'-ATATTTGCTAGACTGTCGCTCCGATCTGTACTTGATGCGATTCGGATCCCCGCTCCGATCGTAGGAGATTGCTGTTTTAC-3' 3'-TATAAACGATCTGACAGCGAGGCTAGACATGAACTACGCTAAGCCTAGGGGCGAGGCTAGCATCCTCTAACGACAAAATG -5' Terminator Promoter O lle-Phe-Ala-Arg O Met-Arg-Phe-Gly O Phe-Ala-Lys-Pro O None of these

Q: Question 17 What is the nucleotide sequence of the DNA strand that is complementary to…

A: The hereditary substance in humans and almost all other animals is DNA, or deoxyribonucleic acid.…

Q: Question 6 of 13 ONA A 5000 GCT AGC CCC ONA B-3 ATA TAT ATA CCCS ONA C-S TAC GTT ACG TOG ONA D3 ATC…

A: Since there are multiple questions and which question is to be solved has not been specified, as per…

Q: Question 17 What is the nucleotide sequence of the DNA strand that is complementary to…

A: Answer- Option D. 5' TAGTGACAGTTGCGAT 3¹

Q: Question 26 The initial event in the conversion of an hnRNA to the mature RNA which leaves the…

A: Answer is D

Q: Where does transcription occur in eukaryotic cells?     in the nucleus     in the cytoplasm…

A: Answer. Transcription is a process of the formation of transcript (RNA). It takes place by the usual…

Q: QUESTION 12 The images shown depict the initiation and elongation steps in protein translation. P.…

A:

Q: QUESTION 1 Histone proteins have large numbers of charged side chains. residues that interact with…

A: DNA or deoxyribonucleic acid is a polynucleotide chain made of monomeric units of nucleic acids.…

Q: QUESTION NO. 1  Fragile X syndrome is a common form of inherited mental retardation. The mutation in…

A: Since you have asked multiple question, we will solve the first question for you. If youwant any…

Q: QUESTION 13 You have isolated a nonsense mutation caused by a base substitution. This mutation is a…

A: Nonsense mutation: These mutations change a codon in a gene to one of the three termination codons…

Q: Which of the following best explains why there are 64 codons, but only20 amino acids for which they…

A: BASIC INFORMATION TRANSLATION  It is the process in which protein is which formed from the…

Q: QUESTION 39 Histone acetylation leads to which of the following events? Oa. DNA becomes more tightly…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Question / G 3 G2 G1 G 5 G 4 GGU AUG GCC AUG CUC CUc UUC ACG GAG UAC CGG R (the strand) Y CUC GAG…

A: In this image the process of transcription is shown where an mRNA is being translated with the help…

Q: tRNA exits the ribosome at the _______________ site.

A: Transfer RNA is involved in protein synthesis as it brings specific amino acid to the correct…

Q: Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence…

A: A gene is a stretch of DNA that codes for a polypeptide chain and is transcribed into mRNA.

Q: Question 16 All of these can be gene products except A tRNA B proteins (c) dsDNA D) FRNA E) MRNA

A: A gene product is the biological substance produced by the expression of a gene, which might be RNA…

Q: QUESTION 21 Consider the following template strand of DNA: AAT TCA CCC 3' 5 The mRNA made from this…

A: DNA stands for Deoxy-ribonucleic acid. It is a molecule which carries the information of a proteins.…

Q: QUESTION 12 Which of the following is NOT a step in the formation of LTRS? A. Binding of a tRNA…

A: Introduction LTR is A polynucleotide sequence found at each end of an integrated retrovirus genome…

Q: QUESTION 10 Of the proteins listed below, choose all of those that are part of the basal…

A: As per the central dogma of molecular biology, direction of flow of information is DNA →RNA→…

Q: Question 17 In the initial transcribing complex O DNA is double stranded O short abortive…

A: Transcription is the mechanism of copying a gene's DNA sequence to create an RNA molecule. The major…

Q: Question 37 During bacterial RNA chain elongation, proceeds ahead of the transcription bubble…

A: The process by which RNA molecules are synthesized on a DNA template is called transcription.…

Q: QUESTION 3 DNA methylation O a. You cannot methylate DNA O b. Enhances O c. Represses O d. Represses…

A:

Q: Question 12 Which of the following best describes the assembly process to initiate translation in…

A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…

Q: Question 20      Which statement is not true for a genetic code:   Question 20 options:…

A: In eukaryotes, the DNA code is very large and is supercoiled and packaged to make compact…

Q: Question 11 The triplet code allows many amino acids to be specified by more than one codon. Such a…

A: Introduction :- Amino acids are the building blocks of proteins. The building blocks of life are…

Q: Question 7 of 10 Question 7. What are the first three amino acids in the protein that is produced…

A: More closely related species have more comparable "amino acid sequences" in the same protein,…

Q: Question 46 The degeneracy of the genetic code most often involves:     the third base of the codon…

A: Human body is equipped with an quick and efficient immune defense system that helps to protect the…

Q: Question 41 Elongation factor Tu (EF-Tu): A binds initiator tRNA and GTP. binds aminoacyl-tRNA in…

A: The synthesis of protein by using the information present in the mRNA is known as translation. The…

Q: Question 14 Short regions of chromosome 1 were sequenced in a population of C. elegans. These…

A: INTRODUCTION The three common haplotypes are shown, along with their frequencies in the population.…

Q: Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence…

A: Nucleic acid are the macromolecule which carries genetic instructions . Instructions vare passed on…

Q: Question 1: Contrast the roles of tRNA and mRNA during translation and list all enzymes that…

A: Transcription Transcription is the process by which DNA sequence is copied to mRNA, by enzyme RNA…

Q: QUESTION 17 Which of the following best supports the idea that the genetic code is composed of…

A: mRNA is produced by the process of transcription by action of RNA polymerase.

Q: Mutations - Create a nonsense point mutation in this coding region of the gene. Make sure to…

A:

Q: Question 1 DNA TEMPLATE: 3 'GCA TTT GAT AAA TAC CTG AGA TGA CTG ATT GGG GGC AAA 5' 5' CGT AAA CTA…

A: The complementary sequences are DNA sequences that are complementary to each other as per the…

Q: Question 21 Transcription of a typical gene encoding a polypeptide in eukaryotes involves all of the…

A: Transcription is the process that occurs in nucleus of a cell that involves the Synthesis of mRNA…

Q: Which of the following best explains why each codon only codes for a very specific amino

A: Which of the following best explains why each codon only codes for a very specific amino acid?…

Q: Question 27 the RNA polymerase binds at the promoter region Gene is switched ON Gene is switched OFF…

A: Gene expression is the transcription of a particular gene and production of RNA. The gene expression…

Q: Question 2 coding strand is: 5'-TACGATCATAT-3’. This sequence is transcribed. What is the sequence…

A: During transcription only one strand of the transcription unit is transcribed. Transcript is…

Q: Question 28 Intrinsic RNA chain termination is determined by specific sequences in the DNA called…

A: Dna super coils: DNA supercoiling is important for DNA packaging within all cells. Termination…

Q: Question 43 The DNA strand that serves as a template during transcription is known (other than…

A: DNA transcription is the process by which the coded information from the genome is sent to the cell…

Q: QUESTION 7 The below figure depicts the 'transcription tree' of RNA transcription. Use this figure…

A: Transcription is a process of synthesis of RNA from the template strand of DNA by the action of RNA…

Q: Question 13 of 13 DNA A= 5' GGG GCT AGC CCC 3' DNA B= 3' ATA TAT ATA CCC 5' DNA C= 5' TAC GTT ACG…

A: DNA has two antiparallel strands of which one runs in 5'-3' direction and other in 3'-5' direction.…

Q: Question 16 The fact that some eukaryotic FRNAS are self-splicing indicates that (A RNA can contain…

A: Introduction: Introduction: Nucleus is main controller of the cell which possess genetic information…

Q: QUESTION 21 Choose gach of the characteristic(s) of all RNA polymerases from the list below. OA.…

A: RNA Polymerase is an enzyme that does the transcription of DNA into RNA. It uses a DNA strand as a…

Q: In most of the DNA repair processess the end DNA fragments are joined by Question 5 options:…

A: DNA, stands for deoxyribonucleic acid. It is the hereditary material in people and practically any…

Q: QUESTION 19 In the CRISPR Cas9 system, binds to a target sequence of DNA; then cuts the target DNA.…

A: It is a unique technology that enables geneticists and researchers to edit parts of the genome by…

Q: Question 1: The diagram below depicts an eukaryotic gene. In which region would the insertion of a…

A: A particular gene is transcribed into RNA by the process known as transcription and that RNA is…

Q: Which of the following best explains why each codon only codes for a very specific amino acid?…

A: The genetic codon is composed of three successive nucleotides present on the mRNA and the genetic…

Q: Which of the following is not true with respect to eukaryotic genes?   a They contain introns…

A: PROKARYOTES ARE ORGANISMS do not have well defined nucleus , while eukaryotes have well defined…

Q: give answer for  13 and 14 with explanation  asap dont copy

A: DNA contains instruction for forming the protein.  It is a complicated process involving…

Q: tRNA exits the ribosome at the _______________ site.   a E   b P   c A   d X

A: tRNA is an adapter molecule which carry amino acid at one of its end.

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.