QUESTION 14 The Hershey and Chase experiments, in which radioactive phosphorus (32P) and radioactive sulfur (35S) were used, demonstrated that O a. DNA labeled with 32P is transferred from the bacteriophage to the virus O b. DNA may be the hereditary material, although bacteriophages transfer both DNA and proteins into their hosts O C. proteins labeled with 35S become deactivated and unable to be transferred O d. DNA labeled with 35S and proteins labeled with 32P can be traced over the course of an experiment O e. bacteriophages transfer their DNA, not their coat proteins, into their hosts

QUESTION 14 The Hershey and Chase experiments, in which radioactive phosphorus (32P) and radioactive sulfur (35S) were used, demonstrated that O a. DNA labeled with 32P is transferred from the bacteriophage to the virus O b. DNA may be the hereditary material, although bacteriophages transfer both DNA and proteins into their hosts O C. proteins labeled with 35S become deactivated and unable to be transferred O d. DNA labeled with 35S and proteins labeled with 32P can be traced over the course of an experiment O e. bacteriophages transfer their DNA, not their coat proteins, into their hosts

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter12: Dna: The Carrier Of Genetic Information

Section: Chapter Questions

Problem 1TYU: When Griffith injected mice with a combination of live rough-strain and heat-killed smooth-strain...

See similar textbooks

Similar questions

When Griffith injected mice with a combination of live rough-strain and heat-killed smooth-strain pneumococci, he discovered that (a) the mice were unharmed (b) the dead mice contained living rough-strain bacteria (c) the dead mice contained living smooth-strain bacteria (d) DNA had been transferred from the smooth-strain bacteria to the mice (e) DNA had been transferred from the rough-strain bacteria to the smooth-strain bacteria
72) In case of RNA dependent RNA polymerase in Newcastle disease virus (NDV), is a a. Its template is Single stranded DNA b. Its template is Single stranded RNA c. Its product is Double stranded DNA d. Its product is Double stranded RNA
QUESTION 8 What is the function of the amp' gene in a vector? A. It is a restriction enzyme recognition site.. B. It is a selectable marker. O C. It is the origin of replication. O D. It makes the enzyme ß-galactosidase if it is intact, indicating vectors without inserts. O E. It is required for packing into viral shells
What type of mutation is represented in the second strand of DNA? TACGGCACT TACGGCCACT answer choices A. Deletion B. Substitution C. No mutation D. Insertion
All are true for DNA polymerase EXCEPT: / Almal geld vir DNA-polimerase, BEHALWE: A. generates dsDNA from SSDNA / genereer dsDNA vanaf SSDNA B. requires a primer with a free 5'- OH end, but the 3'-end may be phosphorylated / benodig 'n voorvoerder met 'n vrye 5'-OH-groep, maar die 3'-einde kan gefosforileer word. C. copies the sequence of nucleotides of one strand in a complementary fashion. / kopieer die volgorde van nukleotiede van een streng komplementêr. D. synthesizes new strands by adding successive nucleotides in the 5'→3' direction. / sintetiseer nuwe stringe deur opeenvolgende nukleotiede in die 5 '→ 3' rigting toe te voeg. E. copies the sequence of nucleotides of one strand to form a new second strand. / kopieer die volgorde van nukleotiede van een
35. M Heinz Shuster collected the following data on the base composition Move ANALYSIS ribgrass mosaic virus (H. Shuster, in The Nucleic Acids: Chemistry and Biology, vol. 3, E. Chargaff and J. N. Davidson, Eds. New York: Academic Press, 1955). On the basis of this information, is the hereditary information of the ribgrass mosaic virus RNA or DNA? Is it likely to be single stranded or double stranded? Percentage A T U Ribgrass 29.3 25.8 18.0 0.0 27.0 mosaic virus Leibniz Institute for Age Research, Fritz Lipmann-Institute. Ribgrass mosaic virus.
Match each enzyme name in the left column with the correct descriptive phrase in the right column. a. Topoisomerase II b. DNA ligase c. DNA polymerase y d. Reverse transcriptase i. Catalyzes most nucleotide incorporations in bacterial DNA replication ii. Cleaves RNA in a DNA-RNA hybrid molecule e. DNA polymerase I f. DNA polymerase II iii. Uses a tRNA primer in synthesis of retroviral DNA iv. Acts through an adenylylated DNA inter- mediate v. Catalyzes formation of a double-strand DNA break vi. Catalyzes mitochondrial DNA replication
A biological motor used to package double-stranded (ds) DNA into viral capsids is able toexert 50 pN of force. A. If the active site has a surface area of 10^-17 m2 , to what pressure can the biological motor package dsDNA within the viral capsid before stalling? B.If the viral capsid has a radius of 30 nm, how much potential energy is stored due to the pressure-confinement of the dsDNA within the capsid? C. Compare this to thermal energy at room temperature, kBT, where kB=1.38*10^-23 J/K is the Boltzmann constant.
QUESTION 9 which one of these is not required for performing PCR OA template O B. DNA bases OC Reverse transcriptase O D. Primers O D. DNa polymerase
If you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. ATATATATCGCGTTAAATTCTA O b. GCGCGCGCGCGCGCGCGCGCG O c. AAAAAATTTTTCCCCCGGGGG O d. TACTACACTGTGGTTAATTAAA O e. GGGGGCCCCCAATTCCCCCCC tune of proteins that heln in regulating the levels of different molecules in human body, e.g
-66 The following sequence of the DNA template strand contains: 5'AGGCTCCAGG 3' out of Which complementary RNA strand can be made from this sequence? uestion Select one: O a. 5' UCACAGGUCU 3" O b. 5' UCCGAGGUCU 3" O c.5' CCUGGAGCCU 3' O d. 5' UGGCTCCUGC 3' e. 5' GACCTCGGAA 3"
ABO blood group system is defined by the presence of agglutinogens (A and B molecules) at the surface of red blood cells. Enzyme A which leas to the production of the molecule A is coded by all ele A, while enzyme B which leads to the production of the molecule B is coded by allele B, and enzyme O which cannot lead to the production of any molecule is coded by allele O. A part of the coding DNA strand for enzyme A: GAC GTG CGC GCC A part of the coding DNA strand for enzyme B: GAG GTG GcC GCC 5. Compare the non-transcribed strand coding for enzyme A to that coding for enzyme B. 6. Identify the type of mutation involved in this case. Justify. 7. Write the amino acid sequence for both enzymes. 8. "Mutations can lead to diseases or to genetic diversity"Justify by refering to parts A and B. Second letter A G UCU UCC UCA UUG Leu ucG UUU T Phe UUC UAU1- Tyr UACJ Ser UAA Stop UGA Stop UGU), UGCJ UUA UAG Stop UGG Trp CAUTHIS CCU CC CCA CCG CUU CÚC CÁCJ Pro CAA CGU] CGC Arg FLeu CGA CGG CỦA Gln…