Q5. If one strand of a DNA molecule has the following sequence of bases, what will be the sequence of the complementary strand of DNA and mRNA? 5'- ATGTTGCATAGCATGAGCA-3'
Q: In mathematical terms, what characteristic of a graphed line is a measure of enzyme reaction rate?
A: Introduction: Enzymes are macromolecular biological catalysts. Enzymes accelerate chemical reactions...
Q: Bionic Prosthetics What is the state of the technology today?
A: Prosthetic limbs can be defined as the artificial limbs that substitute an amputated body part and a...
Q: 4. What are the problems with a repaired PNS axon?
A: Since you have asked multiple question, we will solve the first question for you. If you want any sp...
Q: summarize basic information with photos: Family name, scientific name, common name, hosts/damage, li...
A: The forest tent caterpillar moth is a moth found all through North America, particularly in the east...
Q: Describe the process of adenovirus cell attachment and entry through to association with the nuclear...
A: A virus, an unseen microorganism, infiltrates our body. It infiltrates our tissues and then intercep...
Q: Explain about small interfering RNAs (siRNAs) ?
A: Small-interfering RNA was discovered in year 1990s as a double-stranded, non-coding RNA molecule tha...
Q: 8) Describe the homeostatic mechanisms that Lacy's body would use to counteract the water deficit
A: Two kidneys are present just near the abdomen area. These are bean-shaped. They are the most essenti...
Q: 4. Identify the following structures and explain their significance in renal physiology? a. Juxtaglo...
A: In this question we have to identify the structure given in the question and have to explain their s...
Q: Signaling by soluble extracellular molecules can be classified as endocrine, paracrine, or autocrine...
A: The systems of signalling are classified that are based on the total amount of distance to which the...
Q: As energy passes from blue-absorbing chlorophylls down to red-absorbing chlorophylls, surprisingly, ...
A: * leaves are the sites of absorbing light directly from sun by exposing their leaves. * Chloroplast ...
Q: Sketch out a plant seedling (no need to draw leaves) based on the following information: Have a sour...
A: * seedling is the young sporophyte of a plant developing from embryo of a seed. *Seedling starts wi...
Q: Explain the concept of Gene Expression Is Regulated by mRNA Stability and Degradation ?
A: Introduction: The control of Gene expression in a eukaryotic cell is done by various levels of biolo...
Q: When phospholipids are carefully mixed with water they are observed to exhibit which of the followin...
A: Phospholipids: Phospholipids, also known as phosphatides, are lipids with a hydrophilic "head" cont...
Q: Below is a short segment of a DNA molecule. Transcribed the DNA codon into mRNA. Use your data sheet...
A: Transcription is the process by which RNA polymerase read out DNA template stand and synthesize mess...
Q: IV. BIOLOGICAL CLASSIFICATION. DIRECTIONS: Determine the correct biological classification for human...
A: Biological classification is classifying or arranging an organism on the basis of the same character...
Q: What is known as Src phosphorylates ZBP1 ?
A: Introduction: The localization of beta-actin messenger RNA to the sites of active actin polymerizati...
Q: Can the catalase reaction be used to check the purity of the starter culture? Explain your answer
A: A starter culture is defined as a preparation of living microorganisms that are purposefully used to...
Q: These sensory receptors when activated result in the movement of both calcium and sodiujm ions throu...
A: Sensory receptors play a key role in responding to stimuli. They can sense different sensations like...
Q: Discuss the location and activation of olfactory receptors and how the brain distinguishes tens of t...
A: Olfactory receptor, also called smell receptor, protein capable of binding odour molecules that pl...
Q: Mutations that affect organisms are those that involve exons. True or False. Defend your answer and ...
A: Introduction : A complete gene consists of Exon and intron . Esona are sequence of DNA or RNA t...
Q: Give a brief description of the jaw patterns of the following: a.Chondricthyes b. Paleonisciform act...
A: Jaw pattern in fishes: Most bony fishes have two sets of jaws made mainly of bone. The primary oral...
Q: what does the term “spillover” mean? Why does this happen?
A: Spillover infection/Pathogen spillover/Spillover event It occurs when a reservoir population with a ...
Q: What is the most interesting in Biology?
A: Introduction: Biology is a branch of science which deals with the relation between a living organism...
Q: Answer the following questions using this tree. Use the following notation to answer the questions b...
A: The phylogenetic tree represent the evolutionary relationship between different organisms. It also h...
Q: What structures play a role in protecting vertebrate central nervous tissue?
A: Definition of CNS The brain plays a central role in the control of most bodily functions, including ...
Q: How is it possible that a given mRNA in a cell is found throughoutthe cytoplasm but the protein that...
A: The translation is a process of conversion of mRNA into specific amino acids in the cytoplasm of a c...
Q: 2. In horses, black coat color is influenced by the dominant allele (B) and chestnut coat color is i...
A: Dihybrid cross It is a cross between two individuals who differ in two observed traits that are con...
Q: Dendritic cell lectins are involved in the transport of virus to lymph nodes: Influenzavirus Varicel...
A: Dendritic cells are part of the adaptive immune response. These cells work as antigen-presenting cel...
Q: Directions: Write the letter of the correct answer to complete the paragraph. Use a separate sheet o...
A: DNA is the genetic material in living organisms that is present within the nucleus, chloroplast and ...
Q: As scientists in Canada traveled further north into colder climates measuring the size(mass) of moos...
A: Bergmann's rule is an ecogeographical rule that claims that larger creatures are found at higher alt...
Q: Give the Positive and negative impacts of Gmo's in social, economic, environment
A: Genetically modified organisms Organism possess different characteristics because of the variety of...
Q: Suppose it is possible to use genetic engineering to make people more intelligent. Do you think this...
A: Recent genetic engineering technology has got miraculous results, which people dreammed for years ag...
Q: Describe the three basic steps in the formation and fusion of autophagosomes.
A: Autophagosomes are double-membraned vesicles that contain cellular material slated to be degraded by...
Q: Complete the table regarding the comparison of the vertebrate digestive system. Write the keywords o...
A: Digestive system The process of conversion of complex food substances to simple and absorbable forms...
Q: In the past 5 years, have GM crops been growing faster in industrialized nations or in developing na...
A: Genetically modified crops are those plants whose genetic material has been altered by gene editing ...
Q: You co-culture the following bacterial strains: an Hfr prototroph and an F- auxotroph for the genes ...
A: Introduction: HFr is a high-frequency recombination bacterial cell whose sex plasmid is attached to ...
Q: Describe the role of pH in regulating the interaction between mannose 6-phosphate and the M6P recept...
A: The term pH stands for hydrogen potential. It is been stated that they are defined to decide whether...
Q: Recall the five steps of the scientific approach.
A: The scientific method is a collection of procedures for examining phenomena, gaining new knowledge, ...
Q: When you go to the pool, do you just swim back and forth continuously? Do you know how to swim the d...
A: Swimming is kind of exercise that can really help body to get fit. 1/2 hour of swimming for 3 days i...
Q: 2 a) What does calcium do in a skeletal muscle cell and where in the cell does it come from? ...
A: Skeletal muscle contraction is a complex phenomenon and involves various processes requiring special...
Q: What binds the zip code of actin mRNAs in the nucleus ?
A: Zipcode binding protein 1 (ZBP1) is responsible for managing the mechanism of the formation of dendr...
Q: Graph of Absorbance vs Time (mins) 1.8 1.6 1.4 1.2 0.8 0.6 0.4 0.2 10 20 30 40 50 60 70 80 Time (min...
A: What is growth rate = it is the number of growth or increase in number of bacteria per unit time Wh...
Q: If an active site of an enzyme is mutated so that it no longer works, what do you think the effect w...
A: Enzyme These are biological catalysts that speed up the rate of the biochemical reaction. Most enzy...
Q: Describe the function/s of the intracytoplasmic membrane found in the following prokaryotes.. a) Ni...
A: Intracytoplasmic membranes(ICM) are plasma membrane infoldings observed in many photosynthetic bacte...
Q: (а) (b) (c) 200 nm 200 nm 200 nm
A: BSE: Backscattered electron imaging mode, image production of sample is formed by the electrons that...
Q: Do plants that are photosynthesis also perform cellular respiration at the same time? Explain
A: Photosynthesis is the process of carbon fixation and carbohydrate production in the presence of Sunl...
Q: What is the time span of each stage of mitosis? Arrange the stages from shortest to longest.
A: The "cell cycle", also known as "cell division", is a set of processes that occur in a cell leading ...
Q: In a laboratory experiment, a researcher reports the use of an isotope 6C14 to trace the synthesis o...
A: C-12 and C-14 are two isotopes of carbon The difference among carbon-12 and carbon-14 is umber of ne...
Q: Briefly explain how bacteriophages can transduce genes between bacteria
A: Introduction :- Bacteriophages (BPs) are bacteria-infecting viruses that kill bacteria without harmi...
Q: When challenged with a low oxygen environment, knownas hypoxia, the body produces a hormone called e...
A: DNA (deoxyribonucleic acid) is wrapped around proteins (known as histones) to form a structure known...
Help me on this ?
Step by step
Solved in 2 steps
- 15/doc.aspx?sourcedoc={dac0ebeb-b019-4578-911c-98.. Search (Option + Q) Review View Help Table O Editing er Av A =Third letter UCAG UCAGH CAC First letter Part 5: Coding Practice 1. Use this sequence of DNA to answer the following former test questions: 5'-- TTAATGGGACAGCTTGTGTAGAGG --3' a. What is the complementary strand of DNA? b. Using the complementary strand of DNA (your answer from part a) as the template strand, what is the transcribed mRNA sequence? C. What is the amino acid sequence translated from the strand of mRNA synthesized in part b (use the genetic code below)? Remember: i. Start codon! ii. Stop codon! bac ocent Seond letter UUU Phe UAU Tyr UGU UGC Cys UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp G C. UUA UCA UUG Le UCG [ CAU ] CAC CUU CGU His CUC C CGC ne. CCA Arg Pro CUA CAA CGA CCG CAG Gin CGG CUG AAU 1 AAC Asn ACU AGU [ [ AUU AUC Ile AGC Ser Thr A AUA AGA AGG ACA AAA Arg AUG Met ACG AAG GUU GCU GAU GGU Asp GAC GCC GGC GUC Val G GUA GCA Ala GAA GGA Gly GAG Glu GGG GUG GCGG-Unit 5: DNA anc X https://docs.goog x y google classroom x A Classes QLSeyPC6Kmoa0k5JJd1DWGzqqRwaQQobHNOOdqFX_aDbV_6-bKw/formResponse of Distance Le... Launch Meeting - Z.. 4 2020 HORNETS 4N... StudentVUE Clear s How is a protein made in the cell? * One strand of DNA in the ribosome combines with amino acids. Two strands of DNA in the nucleus combine with amino acids. One strand of RNA in the ribosome is the template (model) for an amino acid sequence. Two strands of RNA in the nucleus are the template (model) for an amino acid sequence. Use the chart to determine the correct amino acid that this DNA would code for - ATA EGFL Y. UCAGUCAG Gutame Aspart acMutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________A Meet - rfc-prp x A G-Unit 5: DNA an X 4 https://docs.goog x y google classroom xP Classes cs.google.com/forms/d/e/1FAlpQLSeyPC6Kmoa0k5JJd1DWGzqqRwaQQobHN0OdqFX_aDbV_6-bKw/formResponse x New Tab D YouTube Маps E Copy of Distance Le. Launch Meeting - . 2020 HORNETS 4N. O StudentVUE 2 Mr. Nussbaum Lan. A Graphing Lines Use the chart to determine the correct amino acid that this DNA would code for - ATA * 1 point GFL E D А Y STOP Alanine U Tyrosine C. STOP Stop V Valine GU Cysteine U Stop G Tryplophan R Arginine G А С U A Leucine S. K Serine A C L UGA Lysine Proline Аsparagine M START H. I R o search 99. Serine ThreonineMutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ______________________________Hello, I would really appiarte help appreciate help. This is a blank question so I am unsure why it was rejected immeditely the first time. Thank you in advance. Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA antisense strand First codon change from TAC to TAT. Third codon change from ACG to ACA. Ninth nucleotide changes from G to T. Nucleotide with adenine (A) base inserted between 3rd and 4th nucleotide. Types of Mutation Changes in the Amino Acid 1. 2. 3. 4.Amino acid Large subunit of ribosome tRN4 Small subunit of ribosome mRNA Anticodon Submit Request Answer Chamon 4rl Torms of Use | Privacy Policy | PermissModified True or False: Write TRUE if the statement is correct, if the statement is false, change the word/ words in (parenthesis) to make it correct 1. Between the two strands of a DNA segment, the nitrogen bases are held together by (phosphodiester bond). 2. When the ribosome encounters (UAG) in the mRNA it will terminate translation. 3. (mRNA) moves from the nucleus to the cytoplasm prior to translation48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letterDNA GAAGGGACAATACTTTCTTAACACTTG MRNA Amino Acid Sequence 1. Which kind of protein molecule did this gene make? 2. How does this protein help the body maintain homeostasis? Conclusion Questions: 1. Examine the protein you created. If the DNA strand that you started with had a change in it (A changed to G), what would happen to the protein made?8:52 Protein 1-10092015113603.pdf https:api.schoology.comv1attachment169963839... Name Class Date Section Protein Synthesis pages 148-153) 7-3 SECTION REVIEW In this section you studied the process of pro- tein synthesis. You learned that the informa- tion that DNA transfers to messenger RNA (MRNA) is in the form of a code. When the information is decoded, chains of amino acids, called polypeptides, are formed. Polypeptides During translation, each MRNA codon in turn make up proteins, which direct biochemical pathways and are responsible for cell structure and movement. The genetic code is determined by the arrangement of the nitrogenous bases in DNA and RNA. A code word in DNA consists of a group of three nucleotides. When transcribed into MRNA, each code word, or codon, desig- nates a specific amino acid that is to be placed in the polypeptide chain. More than one codon may code for a particular amíno acid. The MANA sequence AUG serves as an initiator, or "start," codon. Three other…SEE MORE QUESTIONS