Q: What is trichomacy in primates and why is this considered a beneficial mutation?
A: INTRODUCTION Prosimians, monkeys, apes, and humans are all classified as primates, a group of…
Q: 4. Draw and label a neuron. Be sure to label the following structures: Dendrites, axon, myelin…
A: Introduction The two different cell types that comprise the body's nervous system are neurons and…
Q: ich of the following is not true concerning capillaries? * They are the site of exchange between the…
A: Capillaries are a type of small blood vessels that carry blood. They transport blood, nutrients, and…
Q: (a) Compare a red blood cell and a typical animal cell based on the features given in the following…
A: Cells are the smallest part of the body of an organism and is the most important structural and…
Q: I needed a function dichotomous key not shape or size
A: Monocytes, lymphocytes, eosinophils and neutrophils are all type of white blood cells. White blood…
Q: Our bodies start sweating when we get too hot. What type of heat exchange does sweating promote?…
A: Sweating is a natural mechanism that helps control body temperature. When the body becomes…
Q: rial dilutions: two 10-fold dilutions, followed by a 5-fold dilution, followed by 2-fold dilution.…
A: given that there are 35 cells but volume is not mentioned so let's assume 35 cells are present in 1…
Q: INSTRUCTION: - Answer the question properly - Discuss your answer - Do not copy in Google or here in…
A: Figure 1 depicts the close likeness of Janjucetus hunderi teeth (a-d) and those of the currently…
Q: The antibiotic amphotericin B causes leaks in cells by combining with sterols in the plasma…
A: Amphotericin B is an antibiotic used to treat a wide range of infections, including bacterial and…
Q: 1. What are the expected genotypes and their ratios for the gametes the parents in the crosses below…
A: The phenotype is defined as an individual's physical appearance for any particular trait. It is…
Q: Can you explain how chemotaxis proteins work and the process that takes place with them?
A: Chemotaxis is the movement of an organism or entity in response to a chemical stimulus (chemo- +…
Q: True or false? Humans are among the most genetically similar species in the world.
A: INTRODUCTION A person who belongs to the genus Homo, a species of culture-bearing ape, especially…
Q: 2. Many health issues have been discussed throughout the semester. Identify a lifestyle choice that…
A: Lifestyle choices play a significant role in determining overall health & well-being. By making…
Q: 7. In the binomial naming system, scientific names are written in italics, with the first word…
A: Introduction : A species is classified and named using the binominal nomenclature system, which…
Q: 1) Which sequence represents the correct order of events for the production of necessary complex…
A: Introduction : The interaction of organ systems is essential for the proper functioning of the…
Q: Activity 3b - Diffusion across a semipermeable membrane 1. Define selective permeability. 2. Explain…
A: Activity 3b Selective permeability Cellular membranes have a characteristic called selective…
Q: For each of the samples below, calculate the mean, variance, standard deviation, and standard error…
A: Answer : For females :
Q: How does Mendel’s postulates relate to human beings?
A: Gregor Mendel's postulates have revolutionized the way we look at genetics and human biology. His…
Q: The main sweetener in Mackies Honeycomb is _______________
A: A sweetener adds sweetness in the product in which it is added. It may be of two types natural…
Q: In the space below, draw three plants cells: one that is turgid, one that is flaccid, and one that…
A: Introduction:- Plant cells are eukaryotic cells, consisting of well developed nucleus and other…
Q: For each G protein below, draw an arrow to its downstream effector(s), second messenger(s), and…
A: G proteins, sometimes referred to as guanine nucleotide-binding proteins, are a family of proteins…
Q: In sequencing, dideoxyribonucleotides (ddNTP) are used that terminate the amplification. Why do they…
A: Introduction : DNA sequencing is the process by which the specific sequence of the four nucleotide…
Q: ___________ are often used to exemplify the relations that exist within a scientific experiment…
A: Graphs are frequently used in scientific experiments to visually represent data and variable…
Q: how you would improve upon Gentile's classification in order to make it more effective at…
A: Gentile's classification of motor skills is a system for categorizing motor skills based on their…
Q: What happens to the range of values you obtain as the number of beans in the sample increases? If…
A: As the number of the beans in a bag increases the standard deviation decreases. So if 15 bean…
Q: 3. Name nonessential structural elements of bacteria and their functions
A: Introduction :- Nonessential structural elements of bacteria are components of the bacterium that…
Q: What type of chlorophyll used by cyanobacteria when shaded Chlorophyll a Chlorophyll b…
A: Cyanobacteria form the most important oxygen producing bacteria of the plane and are prokaryotes.…
Q: Place levels of anatomical organization in the correct order from lowest to highest
A: Anatomical organization refers to the fundamental levels of the body which increases in complexity…
Q: According to the endosymbiotic theory, which of the following is NOT true about the evolution of…
A: Because of specialized organelles, eukaryotic cells are more complicated than prokaryotic cells. All…
Q: technical description of how the chemotaxis systems work in gene regulation?
A: Chemotaxis is the movement of cells or organisms in response to chemical gradients, either towards a…
Q: What is the purpose of: A. The concentrated salt solution? B. adding isopropyl alcohol to the…
A: Introduction: DNA extraction is a process in which the DNA is separated from other cellular…
Q: Acute arterial occlusion of a limb, finger or toe will result in several (7) signs consistent with a…
A: Acute arterial occlusion of a limb, finger or toe will result in several signs consistent with a…
Q: What is the structue of dopamin, and suggest the binding interactions of dopamine with the receptor.…
A: The substantia nigra and the hypothalamus are two regions of the brain that release the chemical…
Q: in terms of quantity, which organic macromolecules do you think are least abundanr in the human body
A: A macromolecule, such as a protein or nucleic acid, is a very large molecule crucial to biophysical…
Q: Pigeons display a high color variety, here we try to understand the genetic basis of mixed red &…
A: Epistasis means masking the effect of a particular gene type by a different gene. Epistasis is a…
Q: Consider the plant mirabilis. Can a plant with a variegated phenotype give rise to a leaf patch with…
A: Variegation in plants refers to the presence of differently colored or patterned tissues within the…
Q: Human cells normally have 46 chromosomes. For each of the following stages, state the number of…
A: a) During metaphase of mitosis, there are 46 chromosomes present in a particular cell. b) During…
Q: Explain how the advancements in modern technology influence the performance of today's medical…
A: The advancement and innovation in modern technologies provide huge benefits for clinical trials and…
Q: Pyruvate to phosphoenolpyruvate conversion reaction could be coupled to reaction for the synthesis…
A: Free energy please a very important roll in deciding whether a reaction will proceed or not. Free…
Q: Phylum Porifera: • Construct a Table with five rows and four columns. Column 1 will be labeled…
A: Porifera is a phylum of aquatic animals that include sponges. They are known for their porous and…
Q: Overexpression or underexpression of cytokines or cytokine receptors have been implicated in several…
A: Cytokines are a type of protein molecule produced by cells in the body, including immune cells, that…
Q: Solve the following Solution X = 1 OsM glucose Solution Y = 2.5 OsM glucose • Solution Z = 1 M NaCl…
A: Given that Solution X = 1 OsM glucose Solution Y = 2.5 OsM glucose And Solution Z = 1 M NaCl
Q: What molecules do the following digestive enzymes help to break down? (a) amylase, (b) invertase,…
A: Introduction : Catalysts speed up chemical reactions without getting consumed or getting changed…
Q: Which of the following statements best describes chylomicrons? A type of lipoprotein that transports…
A: An enzyme is a biological molecule (typically a protein) that catalyzes (accelerates) chemical…
Q: Explain how the structure of the skeleton is adapted to suit these functions: -…
A: The internal framework of the human body is represented by the skeleton. At birth, it has about 270…
Q: Synovial joints are more freely moveable than fibrous or cartilaginous joints explain this…
A: An articulation, also known as a joint, is the place where a number of bones contact. According to…
Q: For Dalmatian dogs, the spotted condition is dominant over non-spotted. (a) Using a Punnett square,…
A: The spotted condition is dominant over non-spotted Dalmatian dogs. Symbols- Spotted allele- S…
Q: A DNA molecule contains 28% thymine. What is the % of each purine and of each pyrimidine?
A: DNA is a nucleic acid ,which is a genetic material in the nucleus of the cell.Purines and…
Q: There are many ways you can accomplish a 1000-fold dilution. Propose 3 different serial dilution…
A: Serial dilution is a method for precisely determining a substance's concentration in a solution. To…
Q: 3. Jeg 10 Place the following terms in their correct locations on Figure 1.6. anterior (cranial)…
A: Introduction - The plane is the surface on which the movement occurs or takes place.The axis is the…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Provide an mRNA sequence and the protein for the following DNA sequence 5'TCC GGT CAT'3
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- C A UUU U UUC Phe UCU UCC UCA UAU UAC UAA UAG UGU Cys U UGC Stop UGA Stop Stop UGG Trp G Tyr Ser UUA UUG Leu UCG CUU C CUC CUA CCU Leu ccc CCA CCG CAU CAC CAA His CGU CGC CGA CGG Pro Arg 1st Gin CUG CAG 3rd letter AUU A AUC AUA AUG ACU AAU AAC Ser u letter C Asn AGU AGC AGA AGG lle ACC Thr ACA AAA AAG Lys Arg Met ACG GUU G GUC GUA GUG GCU GCC GCA GCG GAU GAC GAA GAG Asp GGU GGC GGA GGG Val Ala Gly Glu Not all of the following ingredients are necessary for an in vitro translation reaction. Which one would you leave out? A ssDNA template O Cell sap containing ribosomes poly(U) O 14C-PheU UUU UAU 11yr Phe UUC UUA Leu UUG Jle UCU UCC UCA UCG UGU UGC Cys UGA Stop UAG Skop UGG Trp UAC Ser UAA Stop CUU CUC CỦA CUG CAU JHis CAC CGU CGC CGA CGG CCC Leu Pro Arg ССА Delete CCA CG CAA CAG JGIN Gln AUU AUC le AUA AUG Met AGU 1 Ser AGC AGA AGGJArg 1. ACU ACC The ACA ACG AAU M AAC AAA AAG Jlys JAun ATG AAC TAC CTA GGG ACA GAU JAsp GAC GAA GAG JGlu GUU GUC Val G GUA GCU GCC GCA Ala GCG GGU GGC Gly ATG ACC TAG GGA CA GGA GGG GUG G. Compare translation before and after the deletion. What effect might it have on gene function? Asp Daspartic acid lleI isolcucine Thr T threonine Leu L leucine Ser S serine Туr Y tyrosine Glu E glutamic acid Phe F phenylalanine Pro P proline His H histidine Lys K Arg R Gly G glycine lysine Ala A alanine arginine Cys C cysteine Trp W tryptophan Val V valine Gln Q glutamine Met M methionine Asn N asparagine Second Position UGU 1Cy UCU UCC Ser UCA UG UUU Phe UAU UAC Ty UAA Slop UGA Stop UAG Slop UGG Trp UGC UUC U UUA Leu ] low UUG CUU CÚC A Leu CCU CCC Pro…Page 1: Second Letter C 1 2 UUU U UUC UUA Phe UCU UCC UCA UCG UAU UAC UAA UAG UGU Cys U UGC Stop UGA Stop UGG Tyr -- Ser Leu Stop A Trp G UUG CUU C CUC CCU Leu cc CAU His CGU Pro CAC CGC Arg CUA CUG CCA CCG 1st СА Gln CGA CAG CG 3rd letter AUU A AUC AUA AUG ACU ACC ACA AGU Ser AGC u letter AAU AAC AAA AAG Asn He Thr AGA AGG A Arg G Lys Met ACG GUU G GUC GUA GUG GCU GCC GAU Asp GGU GGC U Val GAC GAA GAG Ala Gly GCA GGA GGG Glu GCG 1. Convert the sequence from DNA to Amino Acids. 3-TCACCACTCTGGTCTGGTCATATCTGCCTGATATGAGTACAT - 5' a. direct transcript? b. transcript for translation? c. direction of a? (3' to 5' or 5' to 3') d. direction of a (3' to 5' or 5' to 3') e. translated peptides?
- Second letter UGU UGCCYS UCU UAU UAC Tyr UAA Stop UGA Stop A UAG Stop UGG Trp UUU Phe UUC. UCC Ser UCA UUA Leu UUG S UCG CAU CUU CUC Leu CỦA CGU CCU CC ССА CCG His CAC CGC Pro Arg CAA CGA Gln CUG CAG CGG AGU AGC AGA AAU ACU ACC ACA AUU Ser AUC File A AUA Asn AAC. AAA AAG Thr Lys AUG Met ACG AGG Arg GCU GCC GCA GCG GGU) GGC Gly GUU GUC Val G GUA GAU) Asp GAC Ala GAA Glu GAGJ GGA GUG GGG A mutation takes place during replication and the new DNA strand has the sequence 3'-ATG-5'. What is the codon on an RNA strand transcribed from this series of nucleotides? Which amino acid results from this codon? Use the genetic code to answer this question. Edit View Insert Format Tools Table 12pt Paragraph Av ev T? MacBook Pro 20 00 000 23 $ % & 7 First letter Third letter * OC 全Second letter UUU UUC UUA UUG. UCU UCC UCA UCG UAU Tyr UAC. Ser UAA Skp UGIA Stop UGU UGC. Phe Cys Leu UAG Sop UGG Trp CGU CGC Arg CGA CCU CAU CUU CUC CUA CUG His CAC CAA CAG Gin CCC Pro CCA Leu CCG CGG ACU AAUA AGU ]Ser AUU Asn AAC AGC AGA LArg AGG. AUC Be ACC ACA Thr AAA AUA AUG Met ACG MGys GUU GUC Val GUA GCU GCC GCA GCG Ala GAA Glu GAG GAU GAC Asp GGU GGC Gly GGA GGG GUG You come across four polynucleotide strands. The first is an original RNA strand that codes for a protein; the others are similar to the original RNA strand, except that each displays a point mutation. The point mutations are shown in red. 5' - AUG-UGC-AUU-CCU-GCA-UAA - 3' 5' - AUG-UGA-AUU-CCU-GCA-UAA - 3' 5' - AUG-UGC-AUU-CCC-GCA-UAA - 3' 5' - AUG-UGC-GUU-CCU-GCA-UAA - 3' Original RNA: Mutant RNA 1: Mutant RNA 2: Mutant RNA 3: 1. Based on how they will affect the protein product, identify the type of point mutation (missense, nonsense, silent, or frameshift) present in the Mutants 1, 2, and 3. 2. State which of…C UUU UUC Phe UUA UCU) UCC UCA UAU UAC Tyr UGU UGC Cys Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUG FLeu UCG CUU CUC CCU] СС CAU1 CAC САC His САА Gln CGU CGC Arg Leu Pro CUA CUG ССА CGA CUG J CCGJ Which of the following tRNA anticodons could theoretically base pair effectively with the codons 5'-AAU-3' and 5'-AAC-3' through third-base CAG, CGG AGU AAUASN AGC AUU AUC File A AUA ACU АСС АСА AAC FAsn AAA Ser C Thr AGA Arg A AUG Met ACG AAG Lys AGG GCU] GCC GCA GCG GGU GGC Gly GGA GAU1 GUU GUC GUA GUG Asp GACJ GAA C Val Ala A GAG Glu GGG wobble? 5'-GGG-3' OI. 5'-AUG-3' II. 5'-GUU-3' I. 5'-CAT-3' IV. 5'-AAA-3 V. Third letter UCAG UUAG A, First letter
- ACG< QNA RNA type f base Tyre of Engan desry- bJA Seatwork: DNA or RNA strand ONA NH2 hnu - RU4 NH 4. N- 2 - NH2 но -р-о но- OH онон NH2 H2N 1. NH N: но но 0-P-0-P- OH OH ононSecond letter C UUU UGU UGC. UUC Phe UUA UUG UCU UCC UCA UCGJ UAU1 UAC. Ser UAA Stop UGA Stop A Tyr Leu UAG Stop UGG Trp CAUTHIS CACS CAA GIn CAG CGU CGC Arg CCU CUU CỤC CỦA CUG J CC Leu Pro ССА CGA CCGJ CGGJ AGU Ser ACU АСС ACA AUU AAU Asn AAC AAA AUC le AGA TArg Thr AUA AUG Met ACG AAGLYS AGG GAU GUU) GUC GUA GUG GCU) GCC GCA GACASP GAA AGlu GAGS GGU GGC Gly Val Ala GGA GGG GCGJ Given the following mRNA sequence: 5' GCCCAUGUGGCGCGAGUGAUUUAA 3' Third letter UCAC UCAG UCAG UCAG 등 | First letterhidden message of the cide: 5' - UGAUGAUGAUGAUGCAUGCUAACGAUUCCGCAAUGUCGAUAUCAAUACGUUGACC-3'
- Consider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5'-UACCGAAUGUCU-3' Note for numbers 1 and 2: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu 1. Using the table of the genetic code, determine the sequence of amino acids. 2. If mutation occurs by substitution of the 12th nucleotide with cytidine-5'- monophosphate, what is the resulting amino acid sequence? 3. What type of mutation occurred? Choose from same sense, missense and non-sense.First base U A G U UUU UUC UUA UUG CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met or start Val Second base C A UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala UAU UGU Tyr Cys UAC UGC UAA Stop UGA Stop A UAG Stop UGG Trp CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG His Gin Asn Lys Asp G Glu CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Arg Ser Arg Gly UCAG UCAG ט כ с AG А U ט כ C G Third base A mutation in the DNA that codes for hemoglobin changes the sequence CTC to CAC. This will cause a change in the mRNA from (original) ? to (mutated) __?____, resulting in the addition of the amino acid, (mutated) ____?___, instead of (original) ____?_position position (5' end) position (3' end) UUU Phe - F UUC Phe UAU Tyr Y. UAC Tyr UAA Stop UGU Cys UGC Cys UGA Stop UGG Trp UCU Ser UCC Ser U UUA Leu UUG Leu UCA Ser UCG Ser UAG Stop W 輔 CAU His CGU Arg CGC Arg CGA Arg CGG Arg CUU Leu CCU Pro CUC Leu CCC Pro P. CCA Pro CÁC His CỦA Leu CAA Gln CUG Leu CCG Pro CAG GIn AUU lle ACU Thr AAU Asn AGU Ser AUC lle ACC Thr -T ACA Thr AAC Asn_ AGC Ser AGA Arg AGG Arg A AUA lle AAA Lys EK AAG Lys AUG Met ACG Thr GUU Val GGU Gly GGC Gly GGA Gly GGG Gly GAU Asp D GAC Asp GCU Ala GUC Val -V GUA Val GCC Ala GCA Ala GCG Ala G - A GAA Glu FE GAG Glu GUG Val Nonpolar Polar Basic Acidic Stop codon Table 4.1 Biology: How Life Works, Third Edition © 2019 W. H. Freeman and Company Consider the DNA sequence–3'-CACTGGTAGCGA–5', • What is the sequence of the messenger RNA sequence that is transcribed from this DNA sequence? (Indicate the 5' and 3' ends of the RNA molecule.) • Consult the genetic code that is shown above. What is the amino acid sequence of the…