Please explain how consumption of different fluids affects the renal system Such as sugary and less sugary drinks

Q: he application of genetic engineering.

A: Researchers can transfer desired genes from one plant or animal to another via genetic engineering.…

Q: 15-16. In the fruit fly, vestigial (tiny) wings and hairy body are produced by recessive genes. The…

A: Drosophila is a genus of flies in the family Drosophilidae. Because many species tend to stay around…

Q: Which hormone is produce in the male reproductive system?

A: The male gametes in humans are known as sperms, and the process through which they develop is known…

Q: Discuss how to transform the yeast vector, YEP containing your gene of interest into the host cell.

A: To insert a set of desirable foreign genes into the host genome for replication and expression, a…

Q: uginfile.php/7376125/mod_resource/content/0/Nitrogen%20Disposal%20%20Urea%.. tice Pathwa... 1/ 1 67%…

A: The urea cycle is the important cycle that helps in the elimination of nitrogenous waste products or…

Q: Which are functional units?

A: Functional units mean that part of the body that performs all the essential metabolic and other…

Q: 5. Which of the following statements describe the codominant mode of inheritance? A straight haired…

A: Codominance is the condition where neither allele can mask the expression of the other, that is,…

Q: Match the Proteins (amino acid sequences) with the correct Phenotype for your Schnodhopper.

A: In this simulation activity, you will examine the DNA sequence of a fictitious organism - the…

Q: Which of the following is an example of a genotype? DNA Protein O AaGG Head size

A: Genotype:   The genotype of an organism is the particular arrangement of alleles for a particular…

Q: What are the ecological & economical impact of Covid-19 in general?

A: COVID 19 is an infectious disease that is caused by SARS-CoV-2 virus which can spread from an…

Q: Which of the following is incorrect about the alpha-helix? a. It can be easily identified in the…

A: The alpha helix and beta plated sheath are the secondary structure of proteins. In this case the…

Q: The following is the base sequence of DNA that codes for amino acids 506-510 of the protein that…

A: Introduction  Deoxyribonucleic acid is a polymer made of two polynucleotide chains that coil around…

Q: The following is an endospore staining. What do we call the pinkish-red cells in t picture? -L y a)…

A: Endospores are metabolically inactive cells that are  produced by bacterial cells under unfavourable…

Q: In a study of coat colour in beach mice, researchers measured the darkness of the fur on the backs…

A: Introduction  All of an organism's observable traits, or phenotype, are the outcome of the interplay…

Q: 5. Which of the following is NOT true about polypeptides? The peptide bond that links the amino…

A: Polypeptide is an unbranched chain of amino acids. Amino acids are linked together by peptide bonds.…

Q: Why is developmental biology important

A: Developmental biology is the detail study of various mechanisms which are involve in the process of…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…

A: Given DNA strand:  5' - CCTATGCAGTGGCCATATTCCAAAGCATAGC - 3'

Q: Greg and Susan have Nail- Patella syndrome (NPS). NPS is an autosomal dominant. Greg has a blood in…

A: Introduction  The nails, knees, elbows, and pelvis are abnormal in people with nail-patella…

Q: climate

A: Climate changes can act to directly influence species distributions (e.g., drought, floods, wind) as…

Q: the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by the…

A: The process of formation of messenger RNA with the help of template strand of DNA is called…

Q: N mRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Alanine Arginine…

A: Disclaimer: “Since you have posted a question with multiple sub-parts, we will solve first three…

Q: How can the yeast vector, YEP, containing your desired gene, be inserted into the host cell? Discuss…

A: YEp stands for Yeast Episomal plasmid is a shuttle vector. Shuttle vectors are vectors designed in a…

Q: Q6.9. A dwindling population of 1000 frogs occupies an isolated area in Costa Rica. To help preserve…

A: Introduction :- By dividing the total number of copies of all the alleles at that specific genetic…

Q: ● ● ● Which of the following is NOT an example of innate immune response? Skin • Lysozymes Gastric…

A: Immune system plays a very important role by protecting us from the various invading pathogens. It…

Q: Do phantom perceptions arise from erroneous neural signals from an amputated stump, or from residual…

A: This phenomenon is related to the conscious feeling of the presence of a missing body part like a…

Q: Is protein synthesis necessary for short-term synaptic plasticity, long-term synaptic plasticity, or…

A: INTRODUCTION Synaptic plasticity This is the modifications in strength of synaptic transmission that…

Q: 3. Using the origin (0, 0) and the data for species E, project out to predict how many nucleotide…

A: Disclaimer: - According to Bartleby guidelines, only the 1st three questions (for MCQ) can be…

Q: Does shrimp have a true tail? Or the uropod is just an appendage/part of the abdomen and not…

A: Shrimps are the crustaceans that are the part of arthropods. They have jointed appendages and…

Q: How did the colonists adapt to their natural environments

A: Introduction: The 'natural environment' refers to the non-human-made surrounds and conditions under…

Q: ● MHC II

A: MHC class I molecules (MHC-I) are cell surface recognition elements expressed on virtually all…

Q: What factors affect the stress response?

A: The stress response is a complex process that is regulated by many different factors. These include…

Q: Describe the general immune response against a viral pathogen? Describe thoroughly the innate and…

A: immune responses are triggered by antigens. Antigens are  found on the surface of pathogens…

Q: What is it called when one organism moves from another environment?

A: Environment  It refers to the surrounding or conditions in which an organism lives. It is complex of…

Q: Why nonhomologous end-joining (NHEJ) is helpful ?

A: Non-homologous end joining (NHEJ)  Is a repair process for double-strand DNA breaks. In contrast to…

Q: What is the difference between the science of epidemiology and the practice of medicine. – Look up…

A: Both science and art are necessary for the study of epidemiology and medical practise. Both are…

Q: (b) List TWO (2) types of common food hazards. Describe the properties of bacteria endotoxin based…

A: a)Two types of food hazards 1)Biological hazards :- embody bacterium, parasites, fungi and viruses.…

Q: 1.    Show the different kinds of gametes which can be formed by individuals of the following…

A: Genotype is genetic makeup of organism. So, in this question we need to determine the gametes from…

Q: Determine which primer pair is the best choice. • Explain why the other primers are not good…

A: A brief DNA or RNA sequence serves as the template and controls the production of a complementary…

Q: What is the purpose and process of staging procedures for lymphomas?

A: Lymphoma Cancer of the lymphatic system (  part of the body's germ-fighting network).

Q: 9. Fishkeepers are interested in putting some species of bacteria in their water tanks because of…

A: Ans - c) Nitrification The use of microbes to reduce nitrogen compounds, especially Ammonia the…

Q: Two animals of the same______ are able to breed to produce fertile offspring. A.Class B• Genus ©…

A: The relative position of an organism group (a taxon) within a taxonomic hierarchy is known as…

Q: The first base in the tRNA anticodon loop is also wobbling, that is one tRNA is able to pair with…

A: The DNA and RNA are composed of nucleotides. The nucleotides can form hydrogen bonds with each other…

Q: You are doing a genetics experiment with the fruit fly. In the "F1" generation, you cross two…

A: The alleles are the alternative forms of a gene that are located on the same locas of a homologous…

Q: What are the two proteins/factors produced by cytotoxic - T cells to kill a virally-infected cell-

A: Introduction : It is type of immune cell which  kill certain cells, including foreign cells,…

Q: 9. Use each of the following species concepts to write a claim about whether the dark and light fur…

A: Species are defined as groups of organisms that are similar to each other and are capable of…

Q: What are the key physical and chemical parameters that must be controlled in a fermenter?

A: Fermentation is the process of incomplete oxidation of substrates in absence of oxygen or under the…

Q: 3. If a rabbit with the defective gene is not fed plants with the pigment, what color is its fat?…

A: We are allowed to do only one question or upto three subpart of a question. Please repost the undone…

Q: How do noncellular immune system components, including antibodies, complement, and clotting factors,…

A: The immune system is made up of mainly immune cells. There are different types of cells that play an…

Q: outline the factors that negatively affect the viability of microorganisms in aerosols.

A: An aerosol is a suspension of fine solid particles or liquid droplets in air or another gas.…

Q: All of these are features of an autosomal recessive pedigree EXCEPT: Heterozygotes have a normal…

A: Pedigree analysis is a form of pictorial representation that depicts medical history and structure…