PART B. Building Polymers- LIPIDS: Using three molecules of stearic acid, draw a triglyceride and label the ester linkages between the glycerol molecule and the fatty acid molecules. Show every bond (do not use shorthand).
Q: What kind of eyes do strepsirhines have? How can you tell what species are active during night vs…
A: Approach to Solving the Question:1. **Research on Strepsirhines Eyes**: Firstly, I would delve into…
Q: Rare forms of lymphoma include Question 7 options: A) Hodgkin and…
A: The question is asking to identify the rare forms of lymphoma from the given options.
Q: PLEASE tell me what each pedigree diagram is. so which one is most likely to show a family with…
A: Pedigree A:The key features are that affected individuals appear in multiple generations and both…
Q: please solve this step by step with clear explaination
A: To convert the given amounts of DNA from micrograms (μg) to microliters (μl), we need to use the…
Q: Phytoremediation is the utilization of plants in the clean up of a polluted area. Are Indian…
A: Approach to solving the question: Detailed explanation: Examples: Key references: Biology
Q: What does “descent with modification” mean? a. Populations that change quickly are likely to become…
A: "Descent with modification" is a core concept in evolutionary biology that Charles Darwin…
Q: Explore the differences between positive inducible, positive repressible, negative inducible, and…
A: When an inducer molecule binds to a repressor protein, it undergoes a conformational shift that…
Q: two reasons as to why it is important to understand genetics in everyday life
A: The first reason why understanding genetics is important in everyday life is because it helps us…
Q: Examine each of the following types of organisms. Drag them into the correct order of succession -…
A: Ecological succession refers to the sequential appearance and disappearance of species in a…
Q: Describe the Molecular Structure of Adenosine Triphosphate in Metabolic Money.
A: For the proper functioning of the body, it requires energy. The cells present within the body…
Q: Describe Hemolytic Disease of the Newborn (HDN). Who is at risk for this disease? How can it be…
A: Certainly! Let's dive deeper into Hemolytic Disease of the Newborn (HDN) to understand its causes,…
Q: What are noticeable characteristics of the Aye Aye and how do their skelatons detail their…
A: The Aye-aye (Daubentonia madagascariensis) is a distinctive and unique primate indigenous to…
Q: What programs and resources would you use to help establish the changes to stop the opioid epidemic?
A: Here's a more detailed explanation of the programs and resources that can help establish changes to…
Q: Which of the following is not an explanation for the lack of Hepatitis C eradication? A) High rate…
A: The fact that hepatitis C strains do not exhibit broad resistance to antiviral drugs is not often…
Q: What is the common ancestor of the Galapagos finches? What are the thirteen Galapagos finches? What…
A: Delving deeper into each aspect related to the Galapagos finches: 1. Common Ancestor: The common…
Q: . In prokaryotes and eukaryotes, describe what else is happening to the RNA while RNA polymerase is…
A: RNA synthesis, which is carried out by RNA polymerase, maybe a basic movement in both prokaryotes…
Q: How do finches reconize members of their own species?
A: The objective of the question is to understand how finches, a type of bird, recognize members of…
Q: Genetics Q10
A: The objective of the question is to determine the number of DNA fragments that will be produced when…
Q: There are several instances which challenge the “one gene, one polypeptide” hypothesis. Describe TWO…
A: 1. Alternative splicing is a process that allows for the synthesis of numerous protein isoforms from…
Q: https://journals.lww.com/acsm-essr/Pages/issuelist.aspx You will need to access the journal website…
A: A randomized experiment was conducted to investigate the effects of early physical exercise therapy…
Q: For which of the following transfusion candidates would CMV-negative blood be most likely indicated?…
A: The objective of the question is to identify the group of patients who would most likely require a…
Q: Use the dropdowns to indicate the pattern of methylation and gene expression expected for a…
A: Here's a breakdown of the key points:Somatic cell inheritance: Somatic cells inherit one allele from…
Q: Which of the following contributed to mass extinctions? a. climate change b. continental drift c.…
A: Mass extinctions are the unexpected and widespread loss of biodiversity. These events have…
Q: You have cultured cells in 10mL of medium. You take a sample and view it under a hemocytometer. The…
A: Culture medium is generally referred to as "medium". It is a nutrient-rich solution used to support…
Q: 17
A: The question is asking about the possible outcomes of alternate splicing of a gene that has 6 exons.…
Q: In the role of the P-site and A-site what is: The Processes in the Central Dogma. Identify where…
A: Of course, let's delve into each aspect in more detail:1. Processes in the Central Dogma: -…
Q: What is the advantage of homology-directed repair (HDR) ?
A: One of the most vital cellular processes called homology-directed repair (HDR) is capable for fixing…
Q: Determine if each statement is correct or incorrect: 1. Ecosystems with fewer numbers of species…
A: 1. Ecosystems with fewer numbers of species tend to be less stable. Correct.Ecosystems with fewer…
Q: Answer the following questions regarding the diagram (below) showing translation. The ribosome is…
A: This is the concept of molecular biology and the topic is TranslationTranslation is the process in…
Q: Consider a population of cells where some cells are cooperative and some cells defect (are selfish).…
A: The image shows a payoff matrix for a cell population, indicating cooperative (C) and defective (D)…
Q: I have a vial of F2 offspring resulting from a two-generation cross between true-breeding wildtype…
A: Approach to solving the question:I derived the expected number of fruit flies by applying Mendelian…
Q: Whisker number in a new breed of mouse is controlled by 2 genes. The line with no contributing…
A: When crossing an AaBb mouse with an AaBB mouse, the offspring can have four different genotypes:…
Q: If 85% of diabetic patients are correctly identified by a urine test for glucose, but 25% of…
A: The objective of the question is to determine the sensitivity and specificity of a urine test for…
Q: Explain why pyrimidine is less basic than pyridine
A: The objective of the question is to understand why pyrimidine is less basic than pyridine. This can…
Q: Identify the latitudinal gradient of species richness
A: The latitudinal slope of species richness is an environmental pattern where the number of species…
Q: Students filled three identical flasks with water and placed elodea, a type of aquatic plant, in…
A: Explanation:The presence of dissolved oxygen in water is closely related to the process of…
Q: The traditional organization of the animal family tree of classification is based mostly on a. DNA…
A: Animal categorization into a family tree, or phylogeny, is based on comparable characteristics of…
Q: Answer the following questions about CRISPR below: A.What is a PAM sequence? B.How does the…
A: A. PAM Sequence:A PAM sequence, or Protospacer Adjacent Motif, is a specific DNA sequence that is…
Q: Replication Methods and Central Dogma1. Information about replication2. What happens at each step
A: DNA replication is a crucial process in biology, essential for the accurate transmission of genetic…
Q: (a) 5' 3' GGCGCAGUGGGCUAGCGCCA (b) (((((..AAAAAA. ))))) (၁) AAAGGCCCAU aaaaaa.
A: The H-type pseudoknot is a common RNA structure composed of two helical stems (S1 and S2) and two…
Q: What
A: Patas monkeys, native to the semi-arid regions of Africa, are known for their remarkable speed and…
Q: According to the NOAA and other peer-reviewed scientific journals, why did over 100 long-finned…
A: The mass stranding of long-finned pilot whales in New Zealand in 2017 was a tragic event that…
Q: Sickle cell disease (SCD) affects millions of people throughout the world; the CDC "Centers for…
A: Detailed explanation:Sickle cell disease (SCD) is a genetic disorder characterized by abnormal…
Q: Genetics Q3
A: The objective of the question is to identify the amino acid that corresponds to the given anticodon…
Q: Consider the following two nonhomologous wildtype chromosomes, where letters or numbers represent…
A: AThe rearrangement in scenario A is a tandem duplication, where the duplicated segment GH is…
Q: Explore the differences between positive inducible, positive repressible, negative inducible, and…
A: Positive Inducible Regulation:- In positive inducible regulation, the binding of the regulatory…
Q: Why the answer is 0.60. please explain
A: 1. **Graph Interpretation**: - The graph serves as a visual representation of the changes in the…
Q: Compare the costs and benefits of being an endotherm, and describe strategies endotherms use to…
A: Endothermy, or warm-bloodedness, is a physiological attribute introduced in some animals like as…
Q: make sure it’s correct
A: The genetic code is the system by which the nucleotide sequence of DNA is translated into the amino…
Q: List and describe the three outcomes of complement activation.
A: Detailed explanation:Complement activation is an essential part of the immune response, involving a…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images
- Directions: Draw each structure of the following fatty acid indicated below. 5. Polyunsaturated fatty acid with 18 carbon atoms and three double bonds.Directions: Draw each structure of the following fatty acid indicated below. 4. Monounsaturated with 16 carbon atoms.LIPIDS: Using three molecules of stearic acid, draw a triglyceride and label the ester linkages between the glycerol molecule and the fatty acid molecules. Show every bond (do not use shorthand).
- Directions: Draw each structure of the following fatty acid indicated below. 3. Polyunsaturated fatty acid with 14 carbon atoms.Carbohydrate: Draw two ringed a-D glucose monomers forming a disaccharide (maltose). Make sure to label the glycosidic linkage formed. Note that a specific molecule has been lost after each of these monomers bind together. Which molecule is lost? 2function and identify their chemical structure. 1. What are the different classes of lipids? State their 2. Identify whether the following fatty acids are saturated or unsaturated. a. CH3(CH2)sCH=CH(CH2)7COOH b. CH3(CH2)¬CH=CH(CH2)7COOH c. CH3(CH2)10COOH do d. CH3(CH2)16COOH e. CH;CH2(CH=CHCH2)3(CH2)6COOH 3. Explain the importance of lipid content in the structure of biological membranes
- Part B. Classify Fatty Acids as Saturated or Unsaturated 2. Identify each fatty acid below as saturated or unsaturated: a) CH₂CH₂CH₂CH₂CH₂CH₂CH₂CH₂CH₂CH₂CH₂CH₂CH₂COOH b) CH,CH,CH,CH,CH,CH,CH,CH,CH=CHCH,CH,CH,CH,CH,CH,CH,COOH c) CH₂(CH₂)4(CH=CHCH₂)₂(CH₂) COOH d) CH3(CH₂)10 COOH e) CH₂(CH₂),CH=CH(CH₂),COOH f) CH₂CH₂(CH=CHCH₂)3(CH₂),COOH Fatty acid Saturated or Unsaturated a) b) f)C. Composition of Lecithin Lecithins are composed of phosphoric acid, cholines, esters of glycerol, and two fatty acids; the chain length, position, and degree of unsaturation of these fatty acids vary, and this variation results in different lecithins with different biological functions. Encircle and properly label the components of lecithin in the general structure below. CH2 -0-C-RI CH-0-C-R2 CH3 CH2 -0-P-0-CH2 CH2 N-CH3 `CH3 он Lecithin (phosphatidyl choline) O=U02-CH-CH Gln12 Regions of 2 receptors that interact on dimerization are shown below. Identify the types of interactions between amino acids based on their interacting side chains (figures of amino acids also provided). Receptor 1 Cys36 Cys$2 CH2 Receptor 2 HS-H2 S-CH Ala45 CH, Cys75 Asp68 HN-CH-CH-CH-CHst Lys65 CH Ser53 -CH,-OH HN CH H,C Phe50 Val98 Interacting Amino Acids Type of Interaction Ser53:Gln12 Asp68:Lys65 Cys75:Cys82 Phe50:Val98 Amino Acids: H. H-C-CH,- H-C-CH, H-C-CH,CH,CCH,-N,
- Which is NOT true about fatty acids? Select the correct answer below: In a triglyceride, the fatty acids are attached to each of the three carbons of the glycerol molecule with an ester bond through an oxygen atom Fatty acids have a long chain of hydrocarbons to which a ketone group is attached Fatty acids most commonly contain 12–18 carbons The number of carbons in a fatty acid may range from 4 to 36. Please explain eachExamine the following structure. Fatty acid Fatty acid PO Alcohol Which of the following is the correct classification of this substance? All of these are correct classifications. glycerophospholipid phospholipid complex lipid GlycerolTRUE OR FALSE PROPERTIES OF FATTY ACIDS Contains polar hydrocarbon and non-polar carboxyl groups Carboxyl portion undergoes halogenation Forms ester bond on the hydrocarbon chain PROPERTIES OF POLYUNSATURATED FATS Forms single bonds and double bonds with hydrogen Undergo hydrogenation on bonds saturated with hydrogen Hardens when saturated with hydrogen