our raw sequencing data, from two reactions, are given: 5'-ACCGTCGGTTACGCTTAGA-3' 5'-GTTACGCTTAGATAACACAAG-3' Based on this data, give the sequence of one sequence read: B. Based on this data, give the sequence of one sequence contig: C. So far, the researchers have assembled all the data they have into three sequence contigs. Have they sequenced the whole genome? Briefly explain, in one or two sentences.

our raw sequencing data, from two reactions, are given: 5'-ACCGTCGGTTACGCTTAGA-3' 5'-GTTACGCTTAGATAACACAAG-3' Based on this data, give the sequence of one sequence read: B. Based on this data, give the sequence of one sequence contig: C. So far, the researchers have assembled all the data they have into three sequence contigs. Have they sequenced the whole genome? Briefly explain, in one or two sentences.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
Sanger sequencing originally used 4 lanes in gels. These lanes represented sequences of different lengths obtained by adding: O All of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP) to the reaction vials; together with one of the 4 deoxynucleotides (DATP, DGTP, DCTP and DTTP), one for each lane, in each vial. O One of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP) to the reaction vials; one for each lane O All of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP), together with all of the 4 deoxynucleotides (DATP, DGTP, dCTP and dTTP), to all of the reaction vials O One of the 4 dideoxynucleotides (ddATP; ddGTP; ddCTP; ddTTP) to the reaction vials; one for each lane, together with all of the 4 deoxynucleotides (dATP, DGTP, dCTP and ATTP) in each vial
This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.
As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________
What size DNA fragment would be released after very mild digestion of chromatin with micrococcal nuclease? (This would represent a single cut per nucleosome.) 30 bp O 165 bp 146 bp 200 bp
Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?
This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.
You were going to sequence a rice DNA fragment whose sequence was only know at one end, as shown below. 5’ AAACGATCGAGTCGCATCCAAAATCGATACCC—unknown region 3’ TTTGCTAGCTCTGCGTAGGTTTTAGCTATGGG—unknown region After several tries, you obtained a beautiful sequencing image as shown here: The worked out well partially because you had designed a primer for sequencing the unknown region according to the following guideline: Tm is 55 – 60°C. Ensures primer had a appropriate melting temperature for PCR ans sequencing. The GC content of the primer is the same as the genome/template (rice = 60%, human/Drosophila = 45-50%). A same nucleotide cannot be more than 2 in a row, e.g. CCC, GGGGG, AAA. The secondary structure of the primer must be none or weak. No primer dimers (The primer anneals to itself). 3’ end is the most important: it should not end in A, preferably ends in GG, GC, CG or CC This website can help you design the primer: http://www.oligoevaluator.com/OligoCalcServlet…
Examine the following DNA sequence (only one strand is shown). The shown strand will be referred to as Strand 1. The complementary strand will be referred to as Strand 2: 5’ TTTAAGCCGTACCGATATAATGTAAGGCGAGCTTGACCGTCTTGGGCATCATA 3’ There is an eleven (11) base pair sequence that serves as a replication origin. Write below the most likely 11 nucleotides on this strand that serve as the replication origin. Think carefully about base pairing.
Given the sequence shown below, write the complementary DNA sequence, using the base-pairing rules, as well as the directionality of the strands: 5'- CGAGGCTAGGTTAACCTG-3'
consider the DNA segment with a sequence: 3'-TACGGTACGGGATTG-5'. if the given DNA sample was subjected to ion-torrent sequencing, sketch the expected profile of the sequencing output. assume that the sequential flooding of nucleotides follows the order G-C-A-T.
Design primers that will amplify the following region of DNA (assume this is one strand from a double stranded region of DNA). The primers should be 15 bases in length. Indicate the 5' and 3' ends of the primers. 5' GGATCGATCAAGAACAATGACAGGATCGAGGAATTCAGCCTACGCAGCCCGTAGCTGGAGGGA 3'