mRNA comes from the ______________ and goes to the __________________. a. DNA, Ribosome b. DNA, RNA c. Ribosome, DNA d. RNA, DNA

Q: Choose the combination of answers that most accurately completes the statement. Which of the…

A: Prokaryotes: - These are unicellular organism. Doesn't contain clearly defined nucleus or…

Q: e? A)A gene's promoter sequence is transcribed into mRNA. B)Translation begins at the 5′ end of a…

A: Transcription is the process of formation of mRNA from the DNA.and Translation is the process of…

Q: In order to isolate the DNA or RNA from the cells, what would be the first step? a. to block the…

A:

Q: DNA has the sequence GTA. If this were transcribed into mRNA, what would the RNA codon look like?…

A: Protein synthesis is a process by which a cell makes protein. It has two steps 1) Transcription,…

Q: The function of RNA polymerase is to A) catalyze the formation of phosphodiester bonds between…

A: Gene expression is the process thorough which the DNA directs to form proteins. It involves two…

Q: The RNA components of ribosomes are synthesized in the ________. a. cytoplasm b. nucleus c.…

A: The ribosome is composed of protein and ribosomal RNA .ribosomes involves in carrying the mRNA…

Q: Which of the following best describes mRNA? Group of answer choices a) Complexes with ribosomal…

A: RNAs are produced as a result of transcription process.

Q: The term rRNA refers to ______ RNA.

A: Ribosomal RNA is abbreviated as rRNA.

Q: Briefly describe what you know about the structure of DNA and how DNA is packaged in a cell.

A: Nucleic acid was first discovered by Freidrich Mieshcher and was previously called nuclein. Nuclein…

Q: Fill in the blank with the most appropriate term that is described by the following statement:…

A: Introduction Ribonucleic acid, or RNA, is a long, single-stranded protein-processing chain found in…

Q: A researcher identifies the nucleotide sequence AAC in a long strand of RNA inside a nucleus. In the…

A: When mRNA forms after the transcription, it undergoes into several modification process to become an…

Q: Which description best fits the definition of a messenger RNA? a An RNA that encodes for a protein b…

A: RNA is a single-stranded nucleic acid that aids in protein synthesis in our bodies.

Q: Human genetic material is represented in the diagram below. A The region labeled A is made up of a…

A: Genes include the bases that are used to assemble protein and RNA. The human genome has a wide…

Q: Match each statement below with the correct RNA molecule.   A. rRNA B. mRNA C. tRNA D. uRNA…

A: mRNA contains the codons in the form of triplet of nucleotides during transcription and is…

Q: Which scenario would NOT cause a change to the amino acid that is added to a polypeptide chain? a.…

A: m RNA codes for proteins. This process is called translation.  mutation is change in the DNA…

Q: Select the best answer or answers from the choices given: The information sequence that determines…

A: Introduction  DNA and RNA are the main genetic material found in all the species irrespective of…

Q: The ribosome is needed for translation of mRNA (a) because it has the enzyme that forms peptide…

A: Ribosomes are found on Rough endoplasmic reticulum of a cell (in eukaryotes) , which actively…

Q: Ribosomal RNA ____________________. a. Carries amino acids to the ribosome b. Carries information…

A: It is involved in the synthesis of proteins,  carrying the instructions from the DNA , which itself…

Q: Why are ribosomes important because they help to: a. Read mRNA sequwnces and bind together amino…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Treating a cell with a drug to stop tRNA from doing its job would mean what? A. that ribosomes…

A: Introduction Translation is the process through which a cell uses the genetic information conveyed…

Q: Use the codon table shown above to help answer this question. What protein sequence would a cell…

A: The mRNA sequence is: 5' CCAUGCACCAAUAGAUAACCG 3' The Codon is read in triplet form.

Q: During protein synthesis, one amino acid binds to RNA molecules. a) What is this RNA molecule? b)…

A: The process of formation of Amino acids from mRNA molecule is known as translation.

Q: Use your genetic code (codon) table to answer the next two questions: What type of mutation would…

A: The answer to the above question is given below.

Q: A ribozyme is a. a complex between RNA and a protein. b. an RNA that encodes a protein that…

A: RNA or ribonucleic acid is a single stranded molecule, which is formed after the transcription…

Q: Explain the types of RNA & explain how they play role in the process of protein synthesis.

A: Explain the types of RNA & explain how they play role in the process of protein synthesis.…

Q: ______ molecules deliver amino acids to the site of protein synthesis. a. DNA b. mRNA c. rRNA d.…

A: The process of translation occurs in which proteins are synthesized with the incorporation of amino…

Q: In one sentence how does ribosome relate to DNA

A: The DNA (deoxyribonucleic acid) is the genetic materials in our body and it contain a specific…

Q: Which of the following characteristics does not describe RNA? a. contains uracil b. is…

A: The ribonucleic acid, complex compound of high atomic weight that functions in cell protein…

Q: Use the diagram of a gene below to answer the question. The site of transcription initiation of the…

A: In the cytoplasm or endoplasmic reticulum, the process in which ribosomes synthesize proteins after…

Q: During transcription, ___________________. a. A cell divides to make 2 new cells b. A cell divides…

A: Transcription small explanation is provided in the below step.

Q: Messenger RNA ____________________. a. Carries amino acids to the ribosome b. Carries information…

A: DNA is converted into mRNA, this process is known as transcription. mRNA is converted into protein,…

Q: An RNA that functions as an enzyme is a ________ .a. protein c. ribosomeb. protocell d. ribozyme

A: Introduction: RNA is a single-stranded molecule in many of its biological roles and consists of a…

Q: Define the following terms: a. DNA b. RNA c. genome d. transcription e. fructose

A: All are related to the molecular structure and are biomolecules

Q: Which of the following BEST represents the function of DNA in a cell?

A: Deoxyribonucleic acid, also known as DNA, is a crucial biomacromolecule in living systems. It is a…

Q: Ribosomes play a key role in ________.   a. breaking down fatty acids and amino acids   b. DNA…

A: Ribosomes are an important organelle of the eukaryotic and prokaryotic cell. Prokaryotes carry 70s…

Q: Choose the combination of answers that most accurately completes the statement. Which of these…

A: The largest and broadest category of all groups in the classification of life is known as domain. At…

Q: Use the figure of a tRNA to answer the following question: -E D Aminoacyl TRNA adds an amino acid to…

A: RNA is a type of nucleic acid present in the cells.

Q: Predict what the results would be if mRNA were radioactively labeled instead of polypeptides. Give…

A: mRNA stands for messenger RNA. It is a single-stranded molecule that is complementary to one of the…

Q: The structure where amino acids are put together in order to make proteins is the ________________.…

A: Answer: c). Ribosome   The gene has a region(s) that codes for a protein - like a cookbook has a…

Q: Define the following terms: a. molecular biology b. genetics c. replication d. transcription e.…

A: The Central Dogma is the process of converting the genetic molecule into functional products where…

Q: Although terminally differentiated cells do not divide, the nuclei in these cells are still the site…

A: Cell is the basic structural, functional, and biological unit of all known organisms. The cell…

Q: Use your genetic code (codon) table to answer this question: A tRNA has the anticodon GCU. Which…

A: The anticodon of any one tRNA fits impeccably into the mRNA codon that codes for the amino corrosive…

Q: Discuss the relationship between RNA and the Genetic Code and what that means for protein synthesis.

A: Protein synthesis is a biological process in which cell makes protein and it occurs through two…

Q: After RNA polymerase binds to DNA, it begins making mRNA. What is the name of this process?

A: According to the central dogma, the most common arrangement of information in our cells is: Making…

Q: During translation, __________________. a. A cell divides to make 2 new cells b. A cell divides to…

A: Cell is the basic structural and functional unit of life.

Q: The code on a DNA strand reads G C G T A A T G A. The mRNA strand would read:

A: Given: The code on a DNA strand reads GCGTAATGA.

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.