MEDGAR EVERS COLLEGE PREPARATORY SCHOOL 12. The diagrams below represent some steps in a procedure used in biotechnology. Bacterial DNA X + Foreign DNA Letters X and Y represent the (1) hormones that stimulate the replication of bacterial DNA (2) biochemical catalysts involved in the insertion of genes into other organisms (3) hormones that trigger rapid mutation of genetic information (4) gases needed to produce the energy required for gene manipulation ommon laboratory 15. Which process is illustrated in the diagram C

MEDGAR EVERS COLLEGE PREPARATORY SCHOOL 12. The diagrams below represent some steps in a procedure used in biotechnology. Bacterial DNA X + Foreign DNA Letters X and Y represent the (1) hormones that stimulate the replication of bacterial DNA (2) biochemical catalysts involved in the insertion of genes into other organisms (3) hormones that trigger rapid mutation of genetic information (4) gases needed to produce the energy required for gene manipulation ommon laboratory 15. Which process is illustrated in the diagram C

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter8: Dna Structure And Function

Section: Chapter Questions

Problem 1DAA: HersheyChase Experiments The graph shown in FIGURE 8.5 is reproduced from an original 1952...

See similar textbooks

Similar questions

Question. Rewrite the following sentences after correction. (Subject: Biotechnology) The variation in the length of tandem repeat of microsatellite DNA has serious translational affects as this is due to its coding region. Correct: If one parent has sickle cell anemia and other has carrier genotype than there is 25 % chance that any offspring is carrier. Correct: Sickled WBC block the flow of blood and Calcium as they stick together and caused by frame shift mutation. Correct: The N1303K mutation in the CFTR gene of CF patients is autosomal dominant disorder due to insertion of asparagine at 1303. Correct: If a person RBCs have B surface antigen and it will clump with antigen B such clumping indicates Blood type B. Correct: Indirect ELISA can detect polygenic gene expression. Correct:
Write TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. 1.The primosome complex includes primase, helicase and gyrase. 2.In plasmid DNA biotechnology, plasmid inserted with a “correct" DNA sequence is transferred to bacteria for rapid.
Explain Shortly. I need help The emergence of new molecular biology techniques has allowed researchers to determine DNA sequences quickly and efficiently. A) How could knowledge of a DNA sequence be abused? B) How could knowing a DNA sequence be helpful? C) Would you ever consent to having your DNA sequenced. Explain your answer
B. Restriction Mapping. Single and double digestion of plasmid pMCS326 were performed using the restriction enzymes Alulll and EcoRV. DNA fragments are shown in an electrophoretogram below. Construct a restriction map of plasmid pMCS326 for enzymes Alulll and EcoRV. 20 kb 11 kb 8 kb 6 kb kb 3 Alulll + Alull EcoRV ECORV | || Restriction Map:
Part 4. Putting It Together 1) Consider the diagram below as well as the given information. This diagram represents a piece of circular DNA which was cut in 4 separate reactions (4 different test tubes, each with some of this DNA in it). One digest was done with AvaI, another with ClaI, a third with EcoRV, and a fourth with ScaI. The locations of the recognition sequences for each restriction enzyme are shown along with the location of that site in bp along the circle (it goes clockwise from position 1). You run an agarose gel with a molecular weight marker in the first lane, the AvaI digest in lane 2, the ClaI digest in lane 3, the EcoRV digest in lane 4, and the ScaI digest in lane 5. a) Use the space below and draw out the agarose gel described above. Use your drawing to answer the next questions. b) How many bands of DNA are there in lane 3? c) How many bands of DNA are there in lane 5? d) There would be 2 bands of DNA in lane 4. How big are they? e) Which lane…
Please answer this asap. Thanks, You have discovered a new plasmid RK21 in a unique bacterial community. As a first step towardunderstanding this plasmid, you digest the plasmid with three restriction enzymes: SspI, XhoI andSmaI. You run the digested plasmid DNA on an agarose gel, along with an uncut sample of theRK21 plasmid DNA as a control.Unfortunately you forget to load a DNA ladder, and obtain the following results. Assumecomplete digestion of all samples or all the digests worked completely
Mutated DNA Sequence #3 T A C A C C T T A G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________ Mutated DNA Sequence #4 T A C A C C T T G G C G A C T A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ______________________________
Modified True or False: Write TRUE if the statement is correct, if the statement is false, change the word/ words in (parenthesis) to make it correct 1. (DNA polymerase III) catalyzes the synthesis of new DNA by adding nucleotides to a preexisting chain. 2. The enzymes that synthesize DNA cannot initiate the synthesis of a polynucleotide they need to have a (promoter) first. 3. (DNA gyrase) relaxes the tension created when DNA unwind to avoid supercoiling.
ule 11 Making Cells – 202 Bb Module 11 Making Cells - 2021 X Bb Take Test: "Lab 11 Homework - X + A sunyocc.open.suny.edu/webapps/assessment/take/launch.jsp?course_assessment_id=_109869_1&course_id=_53817_1&c Question Completion Status: D. Organelle A. Two identical that builds copies of DNA microtubule "highways" to guide DNA B. "staple" that holds DNA copies together C. DNA that is same length and has same instructions; one from mother and one from father Click Save and Submit to save and submit. Click Save All Answers to save all answers. Save All Answers MacBook DD 00 000 F8 F6 F7 F4 F5 F2 F3 F1 * $ % & @ # 2 3 4 * CO < O
Available whis.picture. https://www.phys.ksu.edu/gene/photos/sd.html.g will help vou imagine the results for plate
Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…
Mutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________