If you set up an in vitro translation reaction containing poly(ACGU), as template, which of the following products or sets of products would you expect to be synthesized? poly(tyr•val•arg•thr) O poly(thr•arg•val•tyr) O poly(tyr•val) and poly(thr•arg) O poly(tyr) + poly(val) + poly(arg) + poly(thr)
Q: 3- Planning, implementation and evaluation
A: Health Sector is the most important sector of today's world which includes which includes hospitals,…
Q: How many chromosomes are there in a body cell of a person with trisomy 21 condition? Select one: О…
A: Trisomy 21 is a genetic chromosomal disorder . Genetic chromosomal disorders are the diesese occurs…
Q: Draw a Lineweaver-Burk plot for these data. Put both sets of data on the one graph, use a different…
A: If an enzyme follows Michaelis-Menten Kinetics, a plot of the reciprocal of the reaction velocity…
Q: Consider the Michaelis-Menten equation, below: Vmar S V. k + [S] %3D What is the relationship…
A: [S] : Substrate concentration V= Vmax[S]/(Km+[S]) Vmax: Maximum velocity Km: [S] at which V is…
Q: A biological Claisen reaction occurs in the conversion of two acetyl CoA molecules to one…
A: Introduction: The condensation reactions involve the formation of new carbon-carbon bonds. The most…
Q: Determine the number of carbon atoms present and the the total number of phosphate groups present in…
A: In our body, many metabolic pathways occur. In these pathways, Glycolysis also occurs to convert…
Q: Enhancer sequences may be very far from the genes they affect but they are always upstream of the…
A: Enhancer sequence : These are regulatory DNA sequences, when these are bound by transcription…
Q: Which among the following correctly represents the characteristics of an anion exchanger O Anion…
A: Ion exchange chromatography a chromatographic method based on the net charge of the protein.
Q: Solve the following problems using the basic assumptions: 1 NADH --> 2.5 ATP; 1 FADH2 --> 1.5 ATP…
A: When there is no carbohydrates available in the body, the fatty acids undergo β-oxidation to yield…
Q: Consider this intermediate in the derivation of the Michaelis-Menten equation. [E] [S] k-1 + k2 [ES|…
A: Km : The concentration of substrate at which enzyme achieves half Vmax-maximum velocity
Q: Explain what Hepatocyte hopping is
A: Introduction: The liver is the modified exocrine gland and liver cells are made up of hepatocytes.…
Q: hormone level in blood
A: ''Since you have asked multiple question , we will solve the first question for you. If you want any…
Q: What are the steps in extracting DNA from a Banana using simple household materials like dishwashing…
A: DNA extraction from banana is most commonly followed as banana is triploid with three sets of…
Q: How does compromised pyruvate kinase activity lead to anemia?
A: Pyruvate kinase is a catalytic enzyme that catalyzes the final step of glycolysis, which is crucial…
Q: Make a concept map covering about the following: a. SYPHILIS b. Anti-Streptolysin O Test (ASO TEST)…
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…
Q: Describe surroundings at home which reminds you about biochemistry and relate the situation to…
A: Food is the source of macronutrients and micronutrients required for the body. During the process of…
Q: In a single pass through of the b-oxidation pathway, what are products that can be used in a…
A: Introduction: The fatty acids present in our diet or produced through the degradation of…
Q: the 3 major pathways that eventually become entry points of molecules into the Krebs Cycle? What…
A: TCA / Krebs cycle : An ingenious series of reaction catalyzes by eight different enzyme that…
Q: Five amino acids were subjected to normal phase chromatography, and the folkowing Rf val were…
A: Chromatography is the technique of separation of components of a mixture based on their physical…
Q: What purpose was served by filtering the milk sample after the addition of acid?
A: Milk is a white color liquid which is consists of various proteins and vitamins. Milk is an…
Q: Draw a linear disaccharide of glucose. is an alternating alpha (1-4) and b (1-4) linkages energy…
A: Introduction:- The question is all about the structure of glucose that are isomers of each other as…
Q: Step by Step process of Embden-Meyerhof pathway of RBC metabolism Pls Explain as simple as…
A:
Q: What is the purpose of adding APS and TEMED
A: SDS-PAGE stands for Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis is a biochemistry…
Q: How does NanoDrop quantify DNA?
A: Quantitative analysis techniques are used to measure the quantity of a substance in a solution.…
Q: In olfactory neurons, it is estimated that activation of the olfactory receptors results in an…
A: The olfactory epithelium of the nasal roof contains olfactory receptors. Each olfactory receptor is…
Q: Determine the number of carbon atoms present and the the total number of phosphate groups present in…
A: Glycolysis is a major metabolic pathway in the breakdown of carbohydrates such as glucose.…
Q: What is tne value of VX P in tne Table 6? Table 6. Data on Volume-Pressure Relationship Trial volume…
A: Answer- The value of V*P is given below- Trial Volume (L) Pressure (atm)…
Q: a) Lock and key model versus induced fit model of enzyme activity. (b) Competitive and…
A: Introduction: All the biochemical reactions are enzymes catalyzed in a living organism. Enzymes are…
Q: With the aid of diagrams describe the signalling pathway involving inositol 1,4,5 trisphosphate from…
A: Membrane phospholipids can act as precursors from which second messengers can be produced during…
Q: 1.A:Identify the three major chemical buffers of the body B : Choose one and describe the operation…
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first…
Q: Create a diagram showing the biosynthesis of prostaglandin and leukotrienes in the body.
A: Prostaglandins : These are lipid compounds called as eicosanoids, found in tissues in humans and…
Q: Write the following oligopeptide using the one letter code for the amino acids: Cys-His-lle-Leu-Glu…
A: One letter code has been assigned to each and every amino acids and is often used to represent the…
Q: Question #1: Please describe the specific enzymes that you are familiar with that are involved in…
A: " Since you have asked a multiple question , we will solve the first question for you. If you want…
Q: An Autosomal Dominant trait is only evident in the homozygous state. True False
A: A Dominant inheritance occurs when an abnormal gene from one parent is capable of causing disease.
Q: In the RBCs of the patient described above, which of the following would be expected? And give the…
A: Pyruvate kinase enzyme deficiency typically can manifest clinical symptoms on red blood cells…
Q: Table of BSA solution absorbance of concentration at 595nm. BSA Concentration (µg/ml) OD595nm Mean +…
A: Protein concentration is measured or determined using the reference standard curve. Proteins are…
Q: LLNSAMSRLYSLRSS 1.Assuming this sequnce is enitrely alpha helical what is the hydrogen bond donor…
A: The α-helix is an ordered secondary conformation of proteins. An α-helix is stabilized by the…
Q: Consider the beta oxidation of stearic acid (C18:0): How many ATP are generated in complete…
A: Stearic acid has 18 C so 8 cycles are involved in its beta oxidation, One cycle yield 1 FADH2 and 1…
Q: Since in this patient pyruvate kinase is abnormal not only is less pyruvate made but intermediates…
A: Pyruvate kinase deficiency (PKD) is a rare genetic condition that causes hemolytic anemia, or the…
Q: DNA Leading strand: 5' AAA ATA | CGC TTT| TTA ATT | AAC CCC GGG 3' A I B |C| D Exons: A, C, D…
A: hnRNA is a heterogenous RNA , also called as pre mRNA formed by the enzyme called RNA pol 2 ,…
Q: Proteomic analysis by mass spectrometry involves digestion of samples with to generate peptide…
A: Tandem mass spectrometry is a major technique for the peptide/protein sequencing and PTM analysis.
Q: You are using nitrosoguanidine to “revert” mutant nic-2(nicotinamide-requiring) alleles in…
A: Neurospora can be defined as a genus of ascomycetes fungi. The genus name, which means "nerve…
Q: Why are unsaturated fats considered healthier?
A: Unsaturated fatty acids consist of a double bond between molecules of the fatty acid chains, whereas…
Q: What Type of guard column, separation column, and suppressor used for anion- exchange chromatography
A: In the anion-exchange chromatography, the process of separation occurs which is based on the charges…
Q: Consider each of the following disaccharides: a) Label the acetal and hemiacetal in each…
A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: Please solve all part. 9. If 32p-labeled inorganic phosphate were…
A: Glycolysis is undergoing here i.e conversion of the glucose to pyruvate molecules, and we assume…
Q: In Lieberman's Test, what should you do to revert the change caused by the addition of water to the…
A: Liebermann's test is a confirmatory test for the detection of a phenol group. It is also employed in…
Q: The DNA and associated proteins of a eukaryotic chromosome are called Chromatin Chromatosome…
A: Eukaryotic chromosomes are made up of DNA that is tightly coiled around histone protein clusters.…
Q: In own words, give 5 or more reasons why most of the clinical features of the diseases…
A: Mitochondria are an essential component of eukaryotic cells, and their failure has been linked to a…
Q: Determine the amino acids that compose the peptide shown below.
A: Amino acids are compounds with a carboxyl group and amino group attached to the same carbon atom.…
Step by step
Solved in 2 steps
- please list all possible products in a sequencing reaction using ddGTPA as a terminator based on the following sequences of a template : 3'-GGGCTATACCTGACCCTC-5'Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic messenger RNA with DNA from a genomic clone containing the full-length gene corresponding to the mRNA. (a) How many exons does the gene contain? How many introns? (b) Where in this structure would you expect to find a 5′,5′-internucleotide bond? Where would you expect to find a polyadenylic acid sequence?
- Please list all possible products in a sequencing reaction using ddGTP as a terminator based on the following sequence of a template. 3’ – GGGCTATACCTGACCCTC – 5’Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human - globin gene (shown in the figure below (Links to an external site.)) into bacterial cells, hoping the cells will express it and synthesize functional - globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does -globin made by a eukaryotic cell. Explain why and give thoughts as to how to overcome this.Using the genetic code table provided below, write out the sequence of three different possible mRNA sequences that could encode the following sequence of amino acids: Met-Phe-Cys-Trp-Glu C A G U C UUU Phe UCU Ser UUC Phe UCC Ser UCA Ser UUA Leu UUG Leu UCG Ser CUU Leu CCU Pro CUC Leu CUA Leu CUG Leu CCG A CAU His CGU Arg CCC Pro CAC His CGC Arg UAU Tyr UGU Cys U UAC Tyr UGC Cys C Stop UGA Stop Stop UGG Trp UAA A UAG G CCA Pro CAA Gln Pro CAG AUU lle AUC lle AUA lle AUG Met ACG G 등등 Gln CGA Arg CGG Arg ACU Thr AAU Asn AGU Ser ACC AAC Asn AGC Ser Thr ACA Thr Thr AAA Lys AGA Arg AAG Lys AGG Arg GUU Val GCU Ala GAU Asp GGU Gly GGC Gly GUC Val GCC Ala GAC Asp GUA Val GCA Ala GAA Glu GGA Gly GUG Val GCG Ala GAG Glu GGG Gly U C A G U C A G SUAU
- The following polynucleotide was synthesized and used as a template for peptide synthesis in a cell-free system from E. coli. · AUAUAUAUAUAUAU- .. What polypeptide would you expect to be produced? What information would this give you about the code?What is the order of the polypeptide chain shown in the images provided? Starting at the beginning of translation, determine the order of the amino acids in the polypeptide chain shown in this figure. Choose correct amino acids from the drop-down menu. (The choices from drop down menu are below). 1. (Choices): Leucine, Valine, Methionine 2. Leucine, Valine, Glycine 3. Valine, Methionine, Leucine 4. Methionine, Leucine, GlycineConsider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’ 3’-TTCTCCAAGGTTACGTCCGTGAGTGGTTGAGAATTTATTT-5’ If the bottom DNA strand is used as template to transcribe mRNA, predict the amino acid sequence that would result from the process of translation. Met-Ala-Leu-Thr-Gln-Glu-Gly Met-Gly-Ser-Leu-Asn-Ser-Gln Met-Thr-Asn-Ser-Leu-Ala-Gln Met-Gln-Ala-Leu-Thr-Asn-Ser Met-Glu-Ala-His-Trp-Ser-Tyr
- For each of the following sequences, rank them in order (from best to worst) as sequences that could be used to initiate translation according to Kozak’s rules. GACGCCAUGG GCCUCCAUGC GCCAUCAAGG GCCACCAUGGAn RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP and GTP. When this RNA is used in an in vitro translation system, all of the following amino acids could be incorporated into a newly made polypeptide, except: Codon Table Second position C UUU UCU UAU UGU phe tyr сys UUC UCC UAC UGC ser UAA Stop UGA Stop UAG Stop UGG trp UUA UCA UUG UCG CUU CCU CAU CGU leu his ССС pro ССА CỤC САС CGC arg CỦA САА CGA gln CUG CCG CAG CGG AUU ACU AAU AGU asn ser AUC ile ACC thr АCА AAC AGC AUA AAA lys AAG AGA arg AUG met ACG AGG GUU GCU GAU GGU asp GUC GCC ala GCA GẠC GGC val gly GUA GAA GGA glu GUG GCG GAG GGG glycine (Gly) histidine (His) proline (pro) alanine (Ala) arginine (Arg) Third position (3'-end) AGUCAG First position (5'-end)Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The template DNA strand will have the following sequence written in the conventional manner with no orientation indicators: The corresponding tRNA sequence written in the conventional manner with no orientation indicators will be: After translation was complete, the resulting polypeptide underwent post-translational modification wherein the N-terminal Met residue was removed from the polypeptide. Using one-letter abbreviations, the sequence of the resulting polypeptide is