Q: Transcribe the given DNA sequences to mRNA. DNA: 5'-GATCCGC-3' DNA: 5'-TTACGCTAA-3' DNA:…
A: INTRODUCTION The DNA and it's corresponding mRNA is given below.
Q: Which of the following segments of RNA are retained after conversion of a pre-mRNA to a mature mRNA?…
A: RNA: it is of different types such as rRNA, tRNA, mRNA etc.
Q: Which mRNA strand is complementary to this template DNA strand: 5’-CTGCAT-3’? 3’-AUGCAG-5’…
A: Template strand is the strand of DNA molecule on which the mRNA is synthesized. Complementary strand…
Q: A DNA antisense strand contains the following nucleotide base sequence: AGT GTC TTT GAC From this,…
A: The central dogma of molecular biology tells us how protein is made from a DNA sequence. This…
Q: Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA:…
A: Hi, Thanks For Your Question. Answer : Let's Learn Some Basic Concepts First: Transcription : It Is…
Q: in transcription, if the gene to be transcribed is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the…
A: Transcription is the process that involves the synthesis of an RNA molecule from DNA. It is the…
Q: If the template strand of DNA has the sequence 5'AATGCCTATA3', the MRNA sequence that is transcribed…
A: Transcription is the first of several steps in gene expression in which a particular segment of DNA…
Q: For each of the following sequences, fill in either the DNA, the MRNA sequence, or the amino acid…
A: The central dogma is referred as the central processing system which includes the transfer of…
Q: What mRNA is transcribed from each DNA sequen а. 5'-GTTCTАС-3' 3'- -5' b. 5'-ATTTGAAA-3' 3'- -5' с.…
A: The method of constructing an RNA copy of a genetic sequence is known as transcription. That copy,…
Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…
A: The process of producing protein by association of mRNA and ribosomes is called translation. The…
Q: A CODING STRAND of DNA has the sequence 5' ATGCCG 3' what would the resultant mRNA transcript…
A: Coding strand is the strand which contain the sequence that are identical to the mRNA transcript…
Q: Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' 1. Where N stands for any nucleotide, give…
A: *Given DNA sequence is 3'-TACTTNGTNCTNTCN - 5' 1* Here N will be any nucleotide so take Him place…
Q: Without using your textbook, determine what protein sequence would be translated from the mRNA…
A: DNA is the store house of genetic information. This information is in the form of nucleotide…
Q: Given the following DNA, (A) what is the transcript (mRNA) sequence? (B) What might be the amino…
A: Given: DNA sequence
Q: What amino acid sequence is encoded by the following base sequence of an mRNA molecule? Assume that…
A: Base sequence of mRNA Amino acid sequence UUG LEUCINE CCU PROLINE AGU SERINE GAU ASPARTIC…
Q: For each DNA segment: [1] What is the sequence of the mRNA molecule synthesized from each DNA…
A: Gene expression is the process by which the instructions in the DNA is converted into a functional…
Q: I would like to know how you find the non-transcribed DNA sequence when you are given a 5 prime to 3…
A: The central dogma of molecular biology explains the flow of genetic information through the…
Q: Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the…
A: Introduction The process of duplicating a DNA molecule is known as DNA replication. When a cell…
Q: If a DNA sequence is 5’ CGCTAGACT 3’, the complementary DNA sequence will be? If a DNA sequence is…
A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…
Q: If given the following coding strand of DNA, what is the mRNA? What tRNA will be present? (hint -…
A: DNA is a hereditary molecule made up of two polynucleotide chains lies in the nuclues of all…
Q: DNA strand with the sequence 3’ AACGTAACG 5’ is transcribed. What is the sequence of the mRNA
A: Messenger RNA (mRNA) is a single-stranded RNA molecule that is complementary to one of the DNA…
Q: What will be the sequence of mRNA produced by the following stretch of DNA? 3' ATCGGTTAAC 5'…
A: Transcription is the process of synthesis of an RNA molecule from the DNA template strand. Where RNA…
Q: The genetic code uses three bases to encode one amino acid. Why can't the code use only two bases to…
A: Genetic code is a triplet code that consist a set of three nucleotide bases, known as codons. Each…
Q: The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGGT 3'. Starting from the start…
A: The nucleic acids DNA and RNA are found in all living things. The deoxyribose nucleic acid is DNA,…
Q: using the genetic code provided what would be the corresponding polypeptide sequence for the DNA…
A: DNA is a double helical complex molecule which encodes all the information regarding an organism. It…
Q: 1. What mRNA sequence is synthesized from a section of DNA that is 3’-TTGACCT-5’?
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…
Q: What would be the effect on reading frame and gene function if: Two bases were inserted into the…
A: The nucleotide sequence may be DNA (deoxyribonucleic acid) or RNA (Ribonucleic acid). Nucleic acid…
Q: Shown below is the 5' end of an mRNA molecule. What are the first three (N-terminal) amino acids of…
A: Through transcription the DNA molecule is converted into mRNA.
Q: 3’-T A C G G A C T G A C G A T C-5’ What is its Complementary DNA sequence? mRNA sequence…
A: The term mutation refers to the change of DNA sequence which occurs either due to errors in DNA…
Q: Below is the sequence of an mRNA that has just been transcribed. Please translate this sequence as…
A: Let's rearrange the mRNA in the codes of three. ACG UCC AAU GGC AGU GAU UUG AAU CCA ACG codes for…
Q: What polypeptide is coded for by this mRNA sequence? 5'-GCU-GAA-GUC-GAG-GUG-UGG-3'
A: Codons are trinucleotide sequence (DNA, RNA) that codes for specific amino acid and chain of amino…
Q: (a) Write the complementary base sequence for the matching strand in the DNA section shown below:.…
A: DNA is a double stranded helical structure present inside the nucleus. It acts as a hereditary…
Q: How many PAM sequences are present in the sequence below?…
A: Protospacer adjacent motif(PAM) sequence It is a short DNA sequence(usually 2-6 base pairs in…
Q: What is the sequence of bases in the template strand of DNA that codes for the mRNA in Problem?
A: The sequence of mRNA given in the problem is 5'AAA GUU GGC UAC CCC GGA AUG GUG GUC 3' and the…
Q: Part 1: transcription (DNA- mRNA) 1. You are now inside of a cell, looking at a strands of DNA. Look…
A: Genes are the functional segments of DNA.
Q: Translate this RNA sequence into an amino acid sequence: 5'-AUG GGC UAC CGA-3'?
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Which three codons would code for a different amino acid sequence from that coded for by the mRNA…
A: Given: mRNA base sequence: AGU-UCA-CCA Have to determine which three codons will code for a…
Q: 1.List three different mRNA sequences that could encode the amino acid sequence…
A: Amino acids are the building blocks of polypeptide and proteins. The process of making of…
Q: What would be the effect on reading frame and gene function if:Answer each Two bases were inserted…
A: The nucleotide sequence may be DNA (deoxyribonucleic acid) or RNA (Ribonucleic acid). Nucleic acid…
Q: 1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence…
A:
Q: Construct a polypeptide chain by translating the given red strand of the mRNA segment.…
A: Translation It is defined as the process of protein synthesis in which the sequence of mRNA is…
Q: If methionine is the first amino acid incorporated into a heptapeptide, what is the sequenc of the…
A: Each group of three bases in a mRNA constitutes a codon. Each codon specifies an amino acid.
Q: Which of the following anticodons of a tRNA molecule can base pair with three different codons on an…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Which of the following must occur before mRNA can leave the nucleus in a eukaryotic cell? I. Introns…
A: Any cell or creature with a clearly defined nucleus is referred to as a eukaryote. The nucleus of a…
Q: The first nucleotide in mRNA that will be synthesized from DNA below is: 3'-…
A: During the transcription process RNA is produced from the DNA within the nucleus of eukaryotic cells…
Q: Here is a DNA template strand’s sequence and direction: 3’-TACGCGGTAATC-5’ . What is the sequence…
A: The deoxyribonucleic acid (DNA) undergoes the process of transcription for synthesizing the…
Q: If methionine is always the first amino acid incorporated into an oligopeptide, what oligopeptide is…
A: Introduction Gene expression can only occur when the Gene is transcribed into mRNA and then this…
Q: The sequence of part of an mRNA is 5'AUGGGGAACAGCAAGAGUGGGGC CCUGUCCAAGGAG–3' What is the sequence…
A: Given mRNA sequence is 5'AUGGGGAACAGCAAGAGUGGGGC CCUGUCCAAGGAG–3' As we know that, Bases in DNA is…
Q: A particular triplet of bases in the template strand of DNA is 5' AGT 3'. The corresponding codon…
A: ANSWER;- 3'UCA 5' Explain;- Transcription is a process of a particular DNA sequence being copied…
Q: Which of the following is the complementary MRNA sequence to a DNA gene with the sequence 3'…
A: DNA is the basic unit of inheritance. DNA contains genes which are transcribed to messenger RNA and…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
If a polypeptide chain is 30 amino acids, how many
-33
-90
-96
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- TAC-ATA-ACG-CGA-CAA-CTA-AAA-ACT Write the amino acid sequence of the protein that would be formed by translating this plece of DNA. You can use the three letter abbreviations for the amino acid in each box, do not use the name of the full amino acids, Use the abbrevlation of the amino adid exactly as Itswritten in the table (including the appropriate capltalizations For example it your answer for amino acid 1 is"Methionine" you would write MET in the box (not Met or met) Second Later UUU UUUC Phe UCU UAU Ser UAC UAA UAG Tyr UGU Cys U Leu UCA ucG UGC Stop uGA Beop UUG Step UGG Trp G Cuu C cuC CUA CUG CU Leu Coc CCA CG CAU Pro cGu CAC CAA CAG His CGC Arg CGA CGG 1st 3rd letter AUU A AUG AUA AUG ACU le AAU AAC AGU ACC Asn Ser U leBer ACC ACA Mct ACG The AAA AAG ACA Lys AGG Arg acu Val GCC GCA GCG GAU GAC GAA GAG GOU GGC GGA GGG Arp G GUC GUA GUG Ala Gly Glu Seovence of the protein, 1st amino acid. 2nd arnino acid: 3rd amino acid: 4th amino acid Sth amino acid: 6th amino acid: 7th amino…5' G-A-T-A-с-А-А-с-А-т-G-6-A-с-А-т-G-А-с-т3 What would be the first 3 bases in the 5' end of the complementary strand? Indicate the base sequence and the direction of synthesis of a 3-nucleotide RNA primer. Indicate the base sequence and the direction of synthesis of a 5-nucleotide Okazaki fragment (include a 3 nucleotide RNA primer, a total of 8 bases in the sequence). Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair and G-C base pair?If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letter
- what is triple code5:40 If the nonsense mutation is in the last exon of the mRNA, the result would be: O nonsense-mediated decay O truncated mRNA Oa splice variant Ono expression-66 The following sequence of the DNA template strand contains: 5'AGGCTCCAGG 3' out of Which complementary RNA strand can be made from this sequence? uestion Select one: O a. 5' UCACAGGUCU 3" O b. 5' UCCGAGGUCU 3" O c.5' CCUGGAGCCU 3' O d. 5' UGGCTCCUGC 3' e. 5' GACCTCGGAA 3"
- Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.The genetic disorder sickle-cell anemia occurs when the amino acid valine takes the place of glutamate during translation of a hemoglobin chain. Using the table of codons below, determine the mutation in DNA that produces this disorder. 1st position ✓ U C A G Select one: U C serine phenylalanine phenylalanine serine leucine serine leucine serine leucine leucine leucine leucine isoleucine isoleucine isoleucine methionine Table of mRNA Codons 2nd position valine valine valine valine proline proline proline proline alanine alaninc alanine alanine A tyrosine tyrosine a. CUC changes to C AG b. GAA changes to GUU c. CTT changes to CAT d. C A G changes to CTC stop stop threonine asparagine threonine asparagine threonine threonine histidine histidine arginine arginine glutamine arginine glutamine arginine lysine lysine G cysteine cysteine stop tryptophan aspartate aspartate glutamate glutamate serine serine arginine arginine glycine glycine glycine glycine 3rd position DCMO U С A G U C A G…Question 31 What will be the MRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA Template 3 - ATTGCGGATGCCCGTATACG -5 O 3- AUUGCGGAUGCCCGUAUACG -5 O 5- AUUGCGGAUGCCCGUAUACG -3 O 5 - AUUGCGGAUGCCCGUAUACG -3 O 3- UAACGCCUACGGGCAUAUGC -5
- During transcription, the nitrogen base adenine on the DNA bonds with the nitrogen base ______________ on the messenger RNAA segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: G G C T A G C T G C T T C C T T G G G G A C C G A T C G A C G A A G G A A C C C C T Template strand with its polarity: 3’ C C G A T C G A C G A A G G A A C C C C T 5’ - Coding strand with its polarity: 3’ G G C T A G C T G C T T C C T T G G G G A 5’ Please write out the mRNA sequence generated by the template strand to produce that polypeptide chain.A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. For each mutant, indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Gly b. Mutant 2: Met-Ser-Pro c. Mutant 3: Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys d. Mutant 4: Met-Ser-Pro-Glu-Gly e. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-Gly